Incidental Mutation 'R6691:Parp3'
ID530421
Institutional Source Beutler Lab
Gene Symbol Parp3
Ensembl Gene ENSMUSG00000023249
Gene Namepoly (ADP-ribose) polymerase family, member 3
SynonymsA930002C11Rik, PARP-3, Adprt3, Adprtl3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6691 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location106470322-106476949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106473692 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 329 (S329P)
Ref Sequence ENSEMBL: ENSMUSP00000123054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047721] [ENSMUST00000067218] [ENSMUST00000112479] [ENSMUST00000123555] [ENSMUST00000125850] [ENSMUST00000156426] [ENSMUST00000214682]
Predicted Effect probably benign
Transcript: ENSMUST00000047721
SMART Domains Protein: ENSMUSP00000038580
Gene: ENSMUSG00000041506

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
low complexity region 47 57 N/A INTRINSIC
coiled coil region 61 102 N/A INTRINSIC
WD40 135 174 1.15e-4 SMART
WD40 177 227 3.09e-5 SMART
WD40 230 269 2.42e-7 SMART
WD40 272 311 9.24e-4 SMART
WD40 313 351 2.4e-2 SMART
WD40 354 404 4.6e0 SMART
Blast:WD40 412 451 1e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000067218
AA Change: S329P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064513
Gene: ENSMUSG00000023249
AA Change: S329P

DomainStartEndE-ValueType
WGR 64 141 1.83e-37 SMART
Pfam:PARP_reg 176 315 8.7e-39 PFAM
Pfam:PARP 317 528 7.1e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112479
AA Change: S334P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108098
Gene: ENSMUSG00000023249
AA Change: S334P

DomainStartEndE-ValueType
WGR 64 141 1.83e-37 SMART
Pfam:PARP_reg 182 319 1.3e-42 PFAM
Pfam:PARP 322 533 7.3e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123464
Predicted Effect probably benign
Transcript: ENSMUST00000123555
AA Change: S329P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123054
Gene: ENSMUSG00000023249
AA Change: S329P

DomainStartEndE-ValueType
WGR 64 141 1.83e-37 SMART
Pfam:PARP_reg 176 315 8.7e-39 PFAM
Pfam:PARP 317 528 7.1e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125630
Predicted Effect probably benign
Transcript: ENSMUST00000125850
SMART Domains Protein: ENSMUSP00000119244
Gene: ENSMUSG00000023249

DomainStartEndE-ValueType
WGR 64 141 1.83e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145396
Predicted Effect probably benign
Transcript: ENSMUST00000156426
SMART Domains Protein: ENSMUSP00000117329
Gene: ENSMUSG00000023249

DomainStartEndE-ValueType
WGR 64 141 1.83e-37 SMART
PDB:4L7U|A 179 202 6e-7 PDB
SCOP:d1a26_1 182 202 5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217303
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PARP family. These enzymes modify nuclear proteins by poly-ADP-ribosylation, which is required for DNA repair, regulation of apoptosis, and maintenance of genomic stability. This gene encodes the poly(ADP-ribosyl)transferase 3, which is preferentially localized to the daughter centriole throughout the cell cycle. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300009A05Rik A G 9: 63,398,954 Y90H probably damaging Het
Agk A G 6: 40,392,690 D337G probably benign Het
Amn A G 12: 111,275,397 H299R possibly damaging Het
Angptl4 A G 17: 33,780,781 probably null Het
AU040320 G A 4: 126,836,670 M563I possibly damaging Het
Cachd1 T C 4: 100,989,486 M1042T probably benign Het
Calcoco2 A G 11: 96,100,108 S247P unknown Het
Cd209c T A 8: 3,945,680 I41L probably benign Het
Ceacam12 T A 7: 18,069,224 V185D possibly damaging Het
Chpt1 A T 10: 88,485,900 probably benign Het
Clca1 G C 3: 145,013,883 A442G probably damaging Het
Cldn8 T C 16: 88,562,535 I167M possibly damaging Het
Cln3 A G 7: 126,579,434 V143A possibly damaging Het
Dusp11 T C 6: 85,961,525 H4R possibly damaging Het
Ephb3 T A 16: 21,214,473 F69Y probably damaging Het
Gm11099 A T 2: 58,859,473 probably benign Het
Grik2 A T 10: 49,272,925 Y521* probably null Het
Igf2r A G 17: 12,689,008 L2143P probably damaging Het
Kcnk1 T C 8: 126,025,231 V192A probably benign Het
Olfr1055 A C 2: 86,347,419 S116A probably damaging Het
Olfr1254 A T 2: 89,788,988 Y121* probably null Het
Pld3 A T 7: 27,532,316 N483K probably benign Het
Rbm33 A T 5: 28,352,546 E252D probably damaging Het
Ryr2 T C 13: 11,594,723 T4406A probably benign Het
Sgsm3 A G 15: 81,008,862 D380G possibly damaging Het
Sorl1 G T 9: 42,002,567 D1355E probably damaging Het
Sptbn1 A G 11: 30,113,984 S1945P probably damaging Het
Ube2m A T 7: 13,036,469 F70I probably damaging Het
Ube3b A G 5: 114,408,124 I664V probably benign Het
Ugt1a7c A G 1: 88,095,656 E179G possibly damaging Het
Vps50 T C 6: 3,504,939 probably null Het
Xpo1 T C 11: 23,286,875 L718P probably damaging Het
Zfp354c A G 11: 50,814,775 I491T probably benign Het
Other mutations in Parp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Parp3 APN 9 106471387 missense probably benign
IGL00827:Parp3 APN 9 106474406 missense probably benign 0.17
IGL02683:Parp3 APN 9 106473185 missense possibly damaging 0.84
R0050:Parp3 UTSW 9 106471401 missense possibly damaging 0.81
R0110:Parp3 UTSW 9 106471796 missense possibly damaging 0.81
R0320:Parp3 UTSW 9 106475812 missense possibly damaging 0.76
R0510:Parp3 UTSW 9 106471796 missense possibly damaging 0.81
R0989:Parp3 UTSW 9 106473082 splice site probably null
R1170:Parp3 UTSW 9 106476005 intron probably benign
R1919:Parp3 UTSW 9 106475117 missense possibly damaging 0.92
R1935:Parp3 UTSW 9 106474732 missense probably damaging 1.00
R1936:Parp3 UTSW 9 106474732 missense probably damaging 1.00
R1958:Parp3 UTSW 9 106474822 unclassified probably null
R2188:Parp3 UTSW 9 106475852 missense probably damaging 0.99
R2919:Parp3 UTSW 9 106473725 missense possibly damaging 0.84
R3014:Parp3 UTSW 9 106471315 missense possibly damaging 0.66
R3429:Parp3 UTSW 9 106474723 missense probably damaging 0.99
R3430:Parp3 UTSW 9 106474723 missense probably damaging 0.99
R3618:Parp3 UTSW 9 106475063 missense possibly damaging 0.81
R3980:Parp3 UTSW 9 106474068 missense probably damaging 1.00
R4840:Parp3 UTSW 9 106473109 missense probably damaging 1.00
R5617:Parp3 UTSW 9 106474505 missense possibly damaging 0.75
R6015:Parp3 UTSW 9 106474282 missense possibly damaging 0.72
R6591:Parp3 UTSW 9 106473692 missense probably benign
R7403:Parp3 UTSW 9 106474853 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- ACCTGTAGCTGTTGCCAGTC -3'
(R):5'- CAAGAAGGACATGCTGCTGG -3'

Sequencing Primer
(F):5'- TCTGTATTGCCTGTGGAGAAGAAAG -3'
(R):5'- TGGCCAGCCCAGAGAATAC -3'
Posted On2018-08-01