Incidental Mutation 'R6691:Angptl4'
ID530434
Institutional Source Beutler Lab
Gene Symbol Angptl4
Ensembl Gene ENSMUSG00000002289
Gene Nameangiopoietin-like 4
SynonymsFIAF, BK89, NG27, HFARP
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6691 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location33773750-33781575 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 33780781 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000002360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002360] [ENSMUST00000173869]
Predicted Effect probably null
Transcript: ENSMUST00000002360
SMART Domains Protein: ENSMUSP00000002360
Gene: ENSMUSG00000002289

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
coiled coil region 104 151 N/A INTRINSIC
FBG 187 404 6.6e-69 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173637
Predicted Effect probably benign
Transcript: ENSMUST00000173869
SMART Domains Protein: ENSMUSP00000133417
Gene: ENSMUSG00000002289

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
coiled coil region 104 147 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174872
Meta Mutation Damage Score 0.6456 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylated, secreted protein containing a C-terminal fibrinogen domain. The encoded protein is induced by peroxisome proliferation activators and functions as a serum hormone that regulates glucose homeostasis, lipid metabolism, and insulin sensitivity. This protein can also act as an apoptosis survival factor for vascular endothelial cells and can prevent metastasis by inhibiting vascular growth and tumor cell invasion. The C-terminal domain may be proteolytically-cleaved from the full-length secreted protein. Decreased expression of this gene has been associated with type 2 diabetes. Alternative splicing results in multiple transcript variants. This gene was previously referred to as ANGPTL2 but has been renamed ANGPTL4. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display decreased levels of triglycerides and cholesterol and a lower increase in body fat after exposure to gut microbiota. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300009A05Rik A G 9: 63,398,954 Y90H probably damaging Het
Agk A G 6: 40,392,690 D337G probably benign Het
Amn A G 12: 111,275,397 H299R possibly damaging Het
AU040320 G A 4: 126,836,670 M563I possibly damaging Het
Cachd1 T C 4: 100,989,486 M1042T probably benign Het
Calcoco2 A G 11: 96,100,108 S247P unknown Het
Cd209c T A 8: 3,945,680 I41L probably benign Het
Ceacam12 T A 7: 18,069,224 V185D possibly damaging Het
Chpt1 A T 10: 88,485,900 probably benign Het
Clca1 G C 3: 145,013,883 A442G probably damaging Het
Cldn8 T C 16: 88,562,535 I167M possibly damaging Het
Cln3 A G 7: 126,579,434 V143A possibly damaging Het
Dusp11 T C 6: 85,961,525 H4R possibly damaging Het
Ephb3 T A 16: 21,214,473 F69Y probably damaging Het
Gm11099 A T 2: 58,859,473 probably benign Het
Grik2 A T 10: 49,272,925 Y521* probably null Het
Igf2r A G 17: 12,689,008 L2143P probably damaging Het
Kcnk1 T C 8: 126,025,231 V192A probably benign Het
Olfr1055 A C 2: 86,347,419 S116A probably damaging Het
Olfr1254 A T 2: 89,788,988 Y121* probably null Het
Parp3 A G 9: 106,473,692 S329P probably benign Het
Pld3 A T 7: 27,532,316 N483K probably benign Het
Rbm33 A T 5: 28,352,546 E252D probably damaging Het
Ryr2 T C 13: 11,594,723 T4406A probably benign Het
Sgsm3 A G 15: 81,008,862 D380G possibly damaging Het
Sorl1 G T 9: 42,002,567 D1355E probably damaging Het
Sptbn1 A G 11: 30,113,984 S1945P probably damaging Het
Ube2m A T 7: 13,036,469 F70I probably damaging Het
Ube3b A G 5: 114,408,124 I664V probably benign Het
Ugt1a7c A G 1: 88,095,656 E179G possibly damaging Het
Vps50 T C 6: 3,504,939 probably null Het
Xpo1 T C 11: 23,286,875 L718P probably damaging Het
Zfp354c A G 11: 50,814,775 I491T probably benign Het
Other mutations in Angptl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Angptl4 APN 17 33781268 missense probably damaging 1.00
R0117:Angptl4 UTSW 17 33780802 missense probably damaging 1.00
R1225:Angptl4 UTSW 17 33781191 missense possibly damaging 0.73
R1491:Angptl4 UTSW 17 33781191 missense possibly damaging 0.73
R1932:Angptl4 UTSW 17 33781275 nonsense probably null
R2055:Angptl4 UTSW 17 33780524 splice site probably null
R2212:Angptl4 UTSW 17 33775418 missense probably damaging 0.99
R2959:Angptl4 UTSW 17 33777034 missense possibly damaging 0.54
R2963:Angptl4 UTSW 17 33777034 missense possibly damaging 0.54
R3877:Angptl4 UTSW 17 33777034 missense possibly damaging 0.54
R3881:Angptl4 UTSW 17 33777034 missense possibly damaging 0.54
R3882:Angptl4 UTSW 17 33777034 missense possibly damaging 0.54
R4646:Angptl4 UTSW 17 33781299 missense probably benign 0.00
R4660:Angptl4 UTSW 17 33777275 intron probably benign
R6192:Angptl4 UTSW 17 33777041 missense probably benign 0.09
R6591:Angptl4 UTSW 17 33780781 critical splice donor site probably null
R7350:Angptl4 UTSW 17 33777110 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCTCTTTCCCCTCGAAG -3'
(R):5'- CCTCAGAGCAGACTGTGAAAG -3'

Sequencing Primer
(F):5'- AAGTCTTGTCTACTCCATTGTCTAGG -3'
(R):5'- CTCAGAGCAGACTGTGAAAGGGTAG -3'
Posted On2018-08-01