Incidental Mutation 'R6741:Vmn2r76'
ID530448
Institutional Source Beutler Lab
Gene Symbol Vmn2r76
Ensembl Gene ENSMUSG00000091239
Gene Namevomeronasal 2, receptor 76
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R6741 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location86225206-86246201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86230352 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 247 (N247D)
Ref Sequence ENSEMBL: ENSMUSP00000127309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165771]
Predicted Effect probably benign
Transcript: ENSMUST00000165771
AA Change: N247D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127309
Gene: ENSMUSG00000091239
AA Change: N247D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 470 1.2e-29 PFAM
low complexity region 476 489 N/A INTRINSIC
Pfam:NCD3G 513 565 3.7e-22 PFAM
Pfam:7tm_3 598 833 1.4e-52 PFAM
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 97% (34/35)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actrt3 A C 3: 30,598,514 F144V possibly damaging Het
Arhgef12 A G 9: 42,972,207 I1342T probably benign Het
Dbn1 A G 13: 55,481,537 probably null Het
Ddx58 A G 4: 40,211,624 I648T probably damaging Het
Defb12 T C 8: 19,114,741 E27G probably benign Het
Dthd1 A T 5: 62,842,946 H537L probably damaging Het
Ep400 A T 5: 110,676,895 S2359T unknown Het
Epha5 T C 5: 84,106,698 I572V possibly damaging Het
Grb10 C A 11: 11,936,717 probably null Het
Hectd2 T C 19: 36,612,359 I628T probably damaging Het
Il17rb T A 14: 30,000,336 Q246L possibly damaging Het
Knop1 C T 7: 118,845,838 R301Q possibly damaging Het
Lrp1b T C 2: 41,245,989 I1770M possibly damaging Het
Mgst1 A C 6: 138,150,838 D66A probably damaging Het
Nags A G 11: 102,146,892 D237G possibly damaging Het
Nfatc2ip T A 7: 126,396,010 Q122L possibly damaging Het
Nod2 T C 8: 88,653,066 V72A probably damaging Het
Notch3 G T 17: 32,143,484 P1389Q probably benign Het
Olfr209 A G 16: 59,361,555 L221P probably damaging Het
Plekhn1 A T 4: 156,221,792 I607N probably damaging Het
Plekho2 C A 9: 65,563,915 R84L probably damaging Het
Prag1 A T 8: 36,147,280 M1329L probably benign Het
Prpsap2 C T 11: 61,740,945 probably null Het
Ptprf A G 4: 118,223,368 S1230P probably benign Het
Rptor T G 11: 119,895,977 L1256R possibly damaging Het
Sesn3 T C 9: 14,320,340 I189T possibly damaging Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc39a4 C T 15: 76,614,083 D385N probably damaging Het
St5 A G 7: 109,545,097 Y534H possibly damaging Het
Tnfsf13b T C 8: 10,007,314 F128S possibly damaging Het
Vmn1r49 A G 6: 90,072,213 V269A probably benign Het
Vmn2r69 T A 7: 85,412,516 E83D probably benign Het
Zmym4 A G 4: 126,915,085 S390P possibly damaging Het
Other mutations in Vmn2r76
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Vmn2r76 APN 7 86228717 missense probably benign
IGL01374:Vmn2r76 APN 7 86225649 missense probably benign 0.02
IGL01419:Vmn2r76 APN 7 86225702 missense probably benign 0.32
IGL01627:Vmn2r76 APN 7 86225663 missense probably damaging 1.00
IGL01730:Vmn2r76 APN 7 86230198 missense probably benign 0.02
IGL01957:Vmn2r76 APN 7 86228717 missense probably benign
IGL02214:Vmn2r76 APN 7 86229930 missense probably benign 0.07
IGL02489:Vmn2r76 APN 7 86228863 missense probably benign 0.41
IGL02543:Vmn2r76 APN 7 86230148 missense probably benign 0.06
IGL02579:Vmn2r76 APN 7 86228753 nonsense probably null
IGL02598:Vmn2r76 APN 7 86228671 missense probably benign 0.05
IGL02720:Vmn2r76 APN 7 86225706 missense probably benign 0.35
IGL02745:Vmn2r76 APN 7 86230287 missense probably benign 0.06
IGL03393:Vmn2r76 APN 7 86229826 missense probably benign 0.01
R0483:Vmn2r76 UTSW 7 86225751 missense probably damaging 1.00
R0513:Vmn2r76 UTSW 7 86228779 missense probably benign 0.01
R0528:Vmn2r76 UTSW 7 86230298 missense possibly damaging 0.80
R0601:Vmn2r76 UTSW 7 86226115 critical splice acceptor site probably null
R0662:Vmn2r76 UTSW 7 86230370 missense probably benign 0.39
R0883:Vmn2r76 UTSW 7 86228696 missense probably benign 0.00
R1532:Vmn2r76 UTSW 7 86230246 missense probably benign 0.02
R1694:Vmn2r76 UTSW 7 86230148 missense probably benign 0.06
R1696:Vmn2r76 UTSW 7 86231256 missense possibly damaging 0.56
R2135:Vmn2r76 UTSW 7 86231011 missense probably benign 0.02
R2151:Vmn2r76 UTSW 7 86230484 missense probably benign
R2181:Vmn2r76 UTSW 7 86225535 missense probably benign 0.00
R2268:Vmn2r76 UTSW 7 86230499 missense probably benign 0.03
R2877:Vmn2r76 UTSW 7 86225993 missense probably benign 0.00
R3155:Vmn2r76 UTSW 7 86225751 missense probably damaging 1.00
R3746:Vmn2r76 UTSW 7 86225555 missense probably benign 0.11
R3799:Vmn2r76 UTSW 7 86226036 missense probably benign 0.00
R3825:Vmn2r76 UTSW 7 86231207 missense probably benign 0.10
R4058:Vmn2r76 UTSW 7 86230300 missense probably benign 0.00
R4237:Vmn2r76 UTSW 7 86230532 missense probably benign 0.00
R4404:Vmn2r76 UTSW 7 86228303 missense probably benign 0.16
R4796:Vmn2r76 UTSW 7 86230444 missense possibly damaging 0.95
R4838:Vmn2r76 UTSW 7 86225525 missense probably damaging 1.00
R5175:Vmn2r76 UTSW 7 86228707 missense probably benign 0.00
R5268:Vmn2r76 UTSW 7 86226059 missense probably damaging 1.00
R5381:Vmn2r76 UTSW 7 86225288 missense probably damaging 1.00
R5531:Vmn2r76 UTSW 7 86225449 missense probably damaging 1.00
R5566:Vmn2r76 UTSW 7 86226078 missense probably damaging 1.00
R5646:Vmn2r76 UTSW 7 86226053 missense probably damaging 0.98
R5664:Vmn2r76 UTSW 7 86245994 critical splice donor site probably null
R5818:Vmn2r76 UTSW 7 86229934 missense probably benign 0.00
R6093:Vmn2r76 UTSW 7 86228261 nonsense probably null
R6651:Vmn2r76 UTSW 7 86228851 missense possibly damaging 0.64
R6750:Vmn2r76 UTSW 7 86225906 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTAAAGGGTGCGCTGTC -3'
(R):5'- AAGGACACATCTGTAGCTATTGG -3'

Sequencing Primer
(F):5'- CCAGCTATCTCAGAATAATGGTGTG -3'
(R):5'- ACACATCTGTAGCTATTGGCATGG -3'
Posted On2018-08-01