Incidental Mutation 'R6741:Il17rb'
ID530464
Institutional Source Beutler Lab
Gene Symbol Il17rb
Ensembl Gene ENSMUSG00000015966
Gene Nameinterleukin 17 receptor B
SynonymsIL17RH1, Evi27, IL-17Rh1, IL-17ER, Il17br
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6741 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location29996135-30008896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30000336 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 246 (Q246L)
Ref Sequence ENSEMBL: ENSMUSP00000113686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016110] [ENSMUST00000122205] [ENSMUST00000135888] [ENSMUST00000136726] [ENSMUST00000224797]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016110
AA Change: Q246L

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000016110
Gene: ENSMUSG00000015966
AA Change: Q246L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:IL17R_fnIII_D1 22 175 4.3e-26 PFAM
Pfam:IL17R_fnIII_D2 176 268 1.3e-11 PFAM
transmembrane domain 287 309 N/A INTRINSIC
Pfam:SEFIR 329 476 3.5e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000122205
AA Change: Q246L

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113686
Gene: ENSMUSG00000015966
AA Change: Q246L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
PDB:4HSA|F 34 276 2e-23 PDB
transmembrane domain 287 309 N/A INTRINSIC
Pfam:SEFIR 329 476 1.7e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135888
SMART Domains Protein: ENSMUSP00000121407
Gene: ENSMUSG00000015966

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:IL17R_fnIII_D1 22 123 1.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136726
SMART Domains Protein: ENSMUSP00000117802
Gene: ENSMUSG00000015966

DomainStartEndE-ValueType
PDB:3JVF|C 13 171 5e-12 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223643
Predicted Effect probably benign
Transcript: ENSMUST00000224797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225746
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor. This receptor specifically binds to IL17B and IL17E, but does not bind to IL17 and IL17C. This receptor has been shown to mediate the activation of NF-kappaB and the production of IL8 induced by IL17E. The expression of the rat counterpart of this gene was found to be significantly up-regulated during intestinal inflammation, which suggested the immunoregulatory activity of this receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are homozygous for a null allele have defects in their response to IL17A or IL17F. In addition this locus is a common site of retoviral integration in BXH2 murine myeloid leukemias and occurred at a CpG island 6 kb upstream of the Il17rb gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actrt3 A C 3: 30,598,514 F144V possibly damaging Het
Arhgef12 A G 9: 42,972,207 I1342T probably benign Het
Dbn1 A G 13: 55,481,537 probably null Het
Ddx58 A G 4: 40,211,624 I648T probably damaging Het
Defb12 T C 8: 19,114,741 E27G probably benign Het
Dthd1 A T 5: 62,842,946 H537L probably damaging Het
Ep400 A T 5: 110,676,895 S2359T unknown Het
Epha5 T C 5: 84,106,698 I572V possibly damaging Het
Grb10 C A 11: 11,936,717 probably null Het
Hectd2 T C 19: 36,612,359 I628T probably damaging Het
Knop1 C T 7: 118,845,838 R301Q possibly damaging Het
Lrp1b T C 2: 41,245,989 I1770M possibly damaging Het
Mgst1 A C 6: 138,150,838 D66A probably damaging Het
Nags A G 11: 102,146,892 D237G possibly damaging Het
Nfatc2ip T A 7: 126,396,010 Q122L possibly damaging Het
Nod2 T C 8: 88,653,066 V72A probably damaging Het
Notch3 G T 17: 32,143,484 P1389Q probably benign Het
Olfr209 A G 16: 59,361,555 L221P probably damaging Het
Plekhn1 A T 4: 156,221,792 I607N probably damaging Het
Plekho2 C A 9: 65,563,915 R84L probably damaging Het
Prag1 A T 8: 36,147,280 M1329L probably benign Het
Prpsap2 C T 11: 61,740,945 probably null Het
Ptprf A G 4: 118,223,368 S1230P probably benign Het
Rptor T G 11: 119,895,977 L1256R possibly damaging Het
Sesn3 T C 9: 14,320,340 I189T possibly damaging Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc39a4 C T 15: 76,614,083 D385N probably damaging Het
St5 A G 7: 109,545,097 Y534H possibly damaging Het
Tnfsf13b T C 8: 10,007,314 F128S possibly damaging Het
Vmn1r49 A G 6: 90,072,213 V269A probably benign Het
Vmn2r69 T A 7: 85,412,516 E83D probably benign Het
Vmn2r76 T C 7: 86,230,352 N247D probably benign Het
Zmym4 A G 4: 126,915,085 S390P possibly damaging Het
Other mutations in Il17rb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Il17rb APN 14 30003680 missense probably damaging 1.00
IGL03151:Il17rb APN 14 30006853 missense probably benign 0.05
R0276:Il17rb UTSW 14 30004380 missense probably damaging 1.00
R0391:Il17rb UTSW 14 30004347 missense probably benign 0.00
R0391:Il17rb UTSW 14 30006155 unclassified probably null
R0408:Il17rb UTSW 14 29996680 missense probably benign 0.02
R2011:Il17rb UTSW 14 29996840 nonsense probably null
R2012:Il17rb UTSW 14 29996840 nonsense probably null
R2057:Il17rb UTSW 14 29997154 missense probably benign 0.01
R2227:Il17rb UTSW 14 30006081 missense probably benign 0.02
R3548:Il17rb UTSW 14 30008772 unclassified probably null
R4199:Il17rb UTSW 14 29996644 missense probably benign
R4578:Il17rb UTSW 14 30002399 missense probably damaging 0.97
R5092:Il17rb UTSW 14 30002376 missense probably benign 0.00
R5928:Il17rb UTSW 14 30004275 critical splice donor site probably null
R6280:Il17rb UTSW 14 30002971 missense probably benign 0.00
R6378:Il17rb UTSW 14 30000363 missense probably damaging 0.97
R6470:Il17rb UTSW 14 30002909 missense probably benign 0.10
R6919:Il17rb UTSW 14 30004271 splice site probably null
R7133:Il17rb UTSW 14 29996871 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACACTGCTTGACTGGGGAG -3'
(R):5'- GAAGTTCTAGGCTTCTCGAGTGAG -3'

Sequencing Primer
(F):5'- ACTGGGGAGAGACTTGCCATC -3'
(R):5'- CTCGAGTGAGTCATTCAGAGTTCAC -3'
Posted On2018-08-01