Incidental Mutation 'R6742:Fasn'
ID530502
Institutional Source Beutler Lab
Gene Symbol Fasn
Ensembl Gene ENSMUSG00000025153
Gene Namefatty acid synthase
SynonymsFAS, A630082H08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6742 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location120805846-120824547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120810453 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1990 (T1990A)
Ref Sequence ENSEMBL: ENSMUSP00000145585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055655] [ENSMUST00000206589]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055655
AA Change: T1992A

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000052872
Gene: ENSMUSG00000025153
AA Change: T1992A

DomainStartEndE-ValueType
Pfam:ketoacyl-synt 1 239 6.8e-73 PFAM
Pfam:Ketoacyl-synt_C 243 360 3.7e-38 PFAM
Pfam:KAsynt_C_assoc 362 474 8.2e-46 PFAM
Pfam:Acyl_transf_1 493 810 9.5e-115 PFAM
Pfam:PS-DH 853 1169 9.9e-24 PFAM
low complexity region 1175 1204 N/A INTRINSIC
Pfam:Methyltransf_12 1238 1337 2e-9 PFAM
PKS_ER 1532 1847 1.44e-147 SMART
PKS_KR 1878 2059 2.33e-42 SMART
Pfam:PP-binding 2119 2185 1.1e-10 PFAM
Pfam:Thioesterase 2235 2494 1.6e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155276
Predicted Effect probably damaging
Transcript: ENSMUST00000206589
AA Change: T1990A

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206637
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene is a multifunctional protein. Its main function is to catalyze the synthesis of palmitate from acetyl-CoA and malonyl-CoA, in the presence of NADPH, into long-chain saturated fatty acids. In some cancer cell lines, this protein has been found to be fused with estrogen receptor-alpha (ER-alpha), in which the N-terminus of FAS is fused in-frame with the C-terminus of ER-alpha. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted mutation of this locus has implicated its product in embryogenesis as all homozygotes and most heterozygotes die prior to birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,678,036 R1440G probably benign Het
Abca13 T A 11: 9,328,168 L3116Q probably damaging Het
Adgb G A 10: 10,411,849 H55Y probably damaging Het
AI182371 G T 2: 35,084,705 probably benign Het
Ank3 T C 10: 69,991,582 probably benign Het
Ccdc127 G T 13: 74,352,923 G20W probably damaging Het
Ccdc149 G A 5: 52,405,133 Q184* probably null Het
Cntrob G A 11: 69,322,923 P14S probably damaging Het
Dnah11 T C 12: 118,113,894 E1288G possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Evpl T C 11: 116,222,814 D1350G possibly damaging Het
Itga2 T A 13: 114,836,525 N1166I possibly damaging Het
Lmtk2 T A 5: 144,148,357 C216S probably damaging Het
Lrp1b T C 2: 41,471,120 D557G probably benign Het
Lrrc32 T C 7: 98,498,832 V273A probably benign Het
Nlrp4f C T 13: 65,187,440 probably null Het
Ntng2 T G 2: 29,200,928 M360L probably benign Het
Pik3c2b A G 1: 133,075,821 S504G probably benign Het
Ppfia4 A C 1: 134,329,171 L104R probably damaging Het
Raph1 A G 1: 60,525,720 S203P probably damaging Het
Rbl1 G A 2: 157,169,998 T679I probably benign Het
Rnase4 G T 14: 51,105,029 R70L probably benign Het
Rnf146 A C 10: 29,347,532 D119E probably damaging Het
Rrp1b A G 17: 32,056,934 H485R probably benign Het
Rwdd4a T A 8: 47,547,963 probably null Het
Scarf2 G A 16: 17,806,487 C552Y probably damaging Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Sox10 T C 15: 79,156,476 N127S probably damaging Het
Speer4a A T 5: 26,036,056 probably null Het
Tars A T 15: 11,394,341 I70N probably damaging Het
Thsd7a C T 6: 12,408,816 V736M probably damaging Het
Timp3 G A 10: 86,300,878 V9M probably benign Het
Tnfrsf1a A T 6: 125,356,948 N55Y probably damaging Het
Trim43a G A 9: 88,588,346 V402I possibly damaging Het
Tshz2 A G 2: 169,883,757 D91G probably damaging Het
Ubac1 T C 2: 26,005,406 D345G possibly damaging Het
Usp4 G A 9: 108,374,239 V538I possibly damaging Het
Vmn2r19 A T 6: 123,329,958 Y475F possibly damaging Het
Vmn2r87 A T 10: 130,472,527 V614E probably damaging Het
Wfdc2 A T 2: 164,562,786 T21S probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp78 A G 7: 6,378,278 E109G probably damaging Het
Zfp873 C A 10: 82,058,422 A19D probably damaging Het
Zfp935 T A 13: 62,454,479 K302N probably damaging Het
Zfpm2 G A 15: 41,101,718 S401N probably benign Het
Other mutations in Fasn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Fasn APN 11 120820539 missense probably damaging 1.00
IGL01014:Fasn APN 11 120817229 missense probably damaging 0.99
IGL01131:Fasn APN 11 120814619 missense probably benign 0.01
IGL01603:Fasn APN 11 120816065 missense probably damaging 0.99
IGL01606:Fasn APN 11 120809023 critical splice donor site probably null
IGL01897:Fasn APN 11 120807939 missense probably damaging 1.00
IGL01899:Fasn APN 11 120820149 splice site probably benign
IGL01987:Fasn APN 11 120818073 missense probably damaging 1.00
IGL02103:Fasn APN 11 120811936 missense probably damaging 1.00
IGL02212:Fasn APN 11 120807903 missense probably damaging 1.00
IGL02294:Fasn APN 11 120810276 missense probably damaging 0.98
IGL02336:Fasn APN 11 120813736 missense possibly damaging 0.48
IGL02417:Fasn APN 11 120820340 missense probably damaging 1.00
IGL02452:Fasn APN 11 120808180 missense probably benign 0.00
IGL02559:Fasn APN 11 120809066 missense possibly damaging 0.51
IGL02724:Fasn APN 11 120809833 missense probably benign 0.41
IGL02862:Fasn APN 11 120818979 missense possibly damaging 0.89
IGL02947:Fasn APN 11 120815676 missense probably damaging 0.99
IGL03025:Fasn APN 11 120818148 missense probably benign 0.01
IGL03131:Fasn APN 11 120810724 missense possibly damaging 0.93
IGL03157:Fasn APN 11 120807909 missense probably benign 0.12
IGL03182:Fasn APN 11 120812726 missense probably damaging 1.00
IGL03370:Fasn APN 11 120812795 missense possibly damaging 0.95
R0019:Fasn UTSW 11 120807998 splice site probably benign
R0019:Fasn UTSW 11 120807998 splice site probably benign
R0243:Fasn UTSW 11 120815315 missense probably benign 0.00
R0304:Fasn UTSW 11 120819936 missense possibly damaging 0.85
R0389:Fasn UTSW 11 120816182 missense probably damaging 1.00
R0449:Fasn UTSW 11 120811068 missense probably benign
R0626:Fasn UTSW 11 120811925 missense probably damaging 0.99
R1037:Fasn UTSW 11 120809451 missense probably benign
R1061:Fasn UTSW 11 120822182 unclassified probably null
R1109:Fasn UTSW 11 120812324 missense possibly damaging 0.77
R1467:Fasn UTSW 11 120811040 missense probably benign 0.07
R1467:Fasn UTSW 11 120811040 missense probably benign 0.07
R1498:Fasn UTSW 11 120815419 missense probably damaging 0.98
R1552:Fasn UTSW 11 120818558 missense probably damaging 1.00
R1568:Fasn UTSW 11 120813249 missense possibly damaging 0.78
R1624:Fasn UTSW 11 120813111 missense probably damaging 1.00
R1774:Fasn UTSW 11 120817171 missense probably damaging 1.00
R1826:Fasn UTSW 11 120808499 splice site probably benign
R1846:Fasn UTSW 11 120813307 missense probably benign 0.00
R2298:Fasn UTSW 11 120813816 missense possibly damaging 0.78
R2513:Fasn UTSW 11 120814748 missense probably damaging 1.00
R3001:Fasn UTSW 11 120809845 missense probably benign
R3002:Fasn UTSW 11 120809845 missense probably benign
R3154:Fasn UTSW 11 120807939 missense probably damaging 1.00
R3434:Fasn UTSW 11 120822773 missense probably damaging 0.99
R4794:Fasn UTSW 11 120811295 missense probably benign 0.36
R4840:Fasn UTSW 11 120813059 missense possibly damaging 0.83
R4863:Fasn UTSW 11 120808828 missense probably damaging 1.00
R4876:Fasn UTSW 11 120812312 missense probably damaging 1.00
R4914:Fasn UTSW 11 120816646 missense probably benign 0.39
R4915:Fasn UTSW 11 120816646 missense probably benign 0.39
R4916:Fasn UTSW 11 120816646 missense probably benign 0.39
R4918:Fasn UTSW 11 120816646 missense probably benign 0.39
R4936:Fasn UTSW 11 120816085 missense probably damaging 1.00
R5025:Fasn UTSW 11 120811908 missense probably benign 0.00
R5092:Fasn UTSW 11 120815036 missense probably benign 0.00
R5120:Fasn UTSW 11 120811391 missense probably benign 0.22
R5175:Fasn UTSW 11 120816369 missense probably benign 0.14
R5183:Fasn UTSW 11 120808882 missense probably benign 0.44
R5506:Fasn UTSW 11 120809510 missense probably benign 0.26
R5557:Fasn UTSW 11 120812426 missense probably benign 0.10
R5614:Fasn UTSW 11 120813328 missense probably benign
R5728:Fasn UTSW 11 120813513 missense probably benign 0.06
R5838:Fasn UTSW 11 120816124 missense probably damaging 0.98
R5959:Fasn UTSW 11 120808564 missense probably damaging 0.99
R6029:Fasn UTSW 11 120820909 missense probably damaging 1.00
R6134:Fasn UTSW 11 120822186 missense probably benign 0.05
R6335:Fasn UTSW 11 120815359 missense probably damaging 0.96
R6452:Fasn UTSW 11 120815411 missense probably damaging 1.00
R6627:Fasn UTSW 11 120818927 missense probably benign 0.10
R6767:Fasn UTSW 11 120817487 missense possibly damaging 0.62
R6927:Fasn UTSW 11 120808289 missense probably benign 0.03
R6976:Fasn UTSW 11 120819867 missense probably damaging 1.00
R7092:Fasn UTSW 11 120820120 missense possibly damaging 0.56
R7157:Fasn UTSW 11 120810465 nonsense probably null
R7373:Fasn UTSW 11 120813976 missense possibly damaging 0.81
X0067:Fasn UTSW 11 120816303 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAAGTAGTCCAGCTCAGGGC -3'
(R):5'- CCTGGCCATGGTAAGAAAGG -3'

Sequencing Primer
(F):5'- AGCTCAGGGCAGGCTTC -3'
(R):5'- AGGCAGGCAGGACTCTG -3'
Posted On2018-08-01