Incidental Mutation 'R6745:Col3a1'
ID530515
Institutional Source Beutler Lab
Gene Symbol Col3a1
Ensembl Gene ENSMUSG00000026043
Gene Namecollagen, type III, alpha 1
SynonymsCol3a-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.844) question?
Stock #R6745 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location45311538-45349706 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 45338622 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087883] [ENSMUST00000186021]
Predicted Effect unknown
Transcript: ENSMUST00000087883
AA Change: D777Y
SMART Domains Protein: ENSMUSP00000085192
Gene: ENSMUSG00000026043
AA Change: D777Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWC 33 89 2.73e-20 SMART
low complexity region 100 140 N/A INTRINSIC
low complexity region 163 227 N/A INTRINSIC
low complexity region 230 248 N/A INTRINSIC
internal_repeat_2 249 284 3.45e-13 PROSPERO
internal_repeat_1 250 290 1.9e-17 PROSPERO
Pfam:Collagen 293 366 7.3e-9 PFAM
low complexity region 368 419 N/A INTRINSIC
internal_repeat_4 423 476 2.52e-11 PROSPERO
internal_repeat_1 427 488 1.9e-17 PROSPERO
internal_repeat_3 427 491 7.39e-12 PROSPERO
internal_repeat_2 456 491 3.45e-13 PROSPERO
Pfam:Collagen 533 592 2.6e-11 PFAM
low complexity region 632 680 N/A INTRINSIC
low complexity region 683 776 N/A INTRINSIC
low complexity region 784 815 N/A INTRINSIC
low complexity region 818 855 N/A INTRINSIC
low complexity region 865 921 N/A INTRINSIC
low complexity region 925 950 N/A INTRINSIC
low complexity region 953 974 N/A INTRINSIC
internal_repeat_4 975 1028 2.52e-11 PROSPERO
internal_repeat_3 976 1029 7.39e-12 PROSPERO
internal_repeat_5 977 991 3.33e-5 PROSPERO
internal_repeat_5 1019 1033 3.33e-5 PROSPERO
low complexity region 1037 1058 N/A INTRINSIC
Pfam:Collagen 1076 1135 5.6e-13 PFAM
Pfam:Collagen 1136 1209 4.3e-11 PFAM
COLFI 1229 1464 5.73e-166 SMART
Predicted Effect unknown
Transcript: ENSMUST00000185687
AA Change: D88Y
Predicted Effect probably benign
Transcript: ENSMUST00000186021
SMART Domains Protein: ENSMUSP00000139802
Gene: ENSMUSG00000026043

DomainStartEndE-ValueType
Pfam:Collagen 3 62 1.5e-11 PFAM
COLFI 96 244 7.9e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190943
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of the fibril-forming type III collagen found in bone, cartilage, dentin, tendon, bone marrow stroma and other connective tissue. The encoded protein forms homotrimeric type III procollagen that undergoes proteolytic processing during fibril formation. A majority of mice lacking the encoded protein die within two days of birth but about 5% of the animals survive to adulthood. The surviving mice exhibit severe cortical malformation and experience significantly shorter lifespan. The mutant mouse named "tight skin 2" exhibiting systemic sclerosis phenotype was found to harbor a missense point mutation in this gene. A pseudogene of this gene has been defined on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Most homozygous mutants die within 48 hours after birth. Surviving mutants have reduced body size, skin lesions, enlarged intestines, and die by 6 months of age from ruptured blood vessels. Occasionally intestinal rupture also results in early death. Heterozygotes exhibit tight skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb G T 10: 10,390,197 T1040K probably damaging Het
Adgrf3 A G 5: 30,203,603 V59A probably benign Het
Ankk1 G T 9: 49,416,180 H566Q probably benign Het
Avil A C 10: 127,014,119 D613A probably benign Het
Bbs9 A G 9: 22,670,836 N613S probably benign Het
Chd1 A G 17: 17,387,167 T326A probably benign Het
Clasp2 A T 9: 113,875,270 R558* probably null Het
Cmbl A G 15: 31,589,787 D221G possibly damaging Het
Creb5 A T 6: 53,604,532 M172L probably benign Het
Crybg3 A G 16: 59,552,244 V2291A possibly damaging Het
Cyp2g1 T G 7: 26,814,179 V181G probably damaging Het
D430042O09Rik T C 7: 125,770,650 S137P probably benign Het
Dclk1 T A 3: 55,477,808 S40T probably damaging Het
Dnah10 G T 5: 124,808,812 M3053I probably damaging Het
Dnah12 T A 14: 26,707,228 I268K probably damaging Het
Dock2 C G 11: 34,705,842 D396H probably damaging Het
Dock2 T A 11: 34,705,843 K395N probably damaging Het
Gpbp1 G A 13: 111,453,385 R59C probably benign Het
Ifi47 T G 11: 49,095,502 I32S probably benign Het
Ighg3 A G 12: 113,360,270 V166A unknown Het
Kdm5d T A Y: 927,112 C617S probably benign Homo
Kif20b T G 19: 34,928,876 S55A possibly damaging Het
Klhl1 C T 14: 96,280,002 probably null Het
Kndc1 C T 7: 139,920,976 T727I probably benign Het
Lrrk1 A T 7: 66,273,001 I298N probably damaging Het
Ly75 C A 2: 60,308,179 R1448L probably damaging Het
Mup4 C T 4: 59,960,091 V58M possibly damaging Het
Nr2c1 T C 10: 94,190,664 F467S probably damaging Het
Olfr112 T A 17: 37,563,579 H244L probably damaging Het
Pla2g4a G T 1: 149,886,230 Q151K probably benign Het
Pom121l2 A T 13: 21,983,698 Q713L probably benign Het
Pomgnt1 T A 4: 116,153,883 S210T probably damaging Het
Prb1 T C 6: 132,209,420 probably null Het
Pyroxd2 T C 19: 42,747,360 D101G probably damaging Het
Ranbp3 A G 17: 56,709,308 D359G probably benign Het
Rgsl1 T A 1: 153,822,317 I531F probably benign Het
Serpina1b T C 12: 103,730,355 N265S possibly damaging Het
Slc51b T C 9: 65,412,930 E85G possibly damaging Het
Stk32c T A 7: 139,122,893 R195W probably damaging Het
Uggt2 T C 14: 119,042,610 T819A possibly damaging Het
Ugt1a9 A T 1: 88,071,176 E116V probably benign Het
Zswim5 C G 4: 116,975,204 P543A probably damaging Het
Other mutations in Col3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Col3a1 APN 1 45347135 missense probably damaging 1.00
IGL00928:Col3a1 APN 1 45340858 intron probably benign
IGL00958:Col3a1 APN 1 45327595 missense unknown
IGL01353:Col3a1 APN 1 45333638 unclassified probably benign
IGL01820:Col3a1 APN 1 45321608 missense unknown
IGL01839:Col3a1 APN 1 45311830 missense unknown
IGL02517:Col3a1 APN 1 45325803 critical splice acceptor site probably null
IGL02879:Col3a1 APN 1 45340959 intron probably benign
IGL02960:Col3a1 APN 1 45328455 missense unknown
IGL03245:Col3a1 APN 1 45331109 unclassified probably benign
IGL03308:Col3a1 APN 1 45330617 splice site probably benign
Kraken UTSW 1 45327866 splice site probably null
IGL03050:Col3a1 UTSW 1 45328925 splice site probably null
PIT4520001:Col3a1 UTSW 1 45335783 critical splice donor site probably null
R0063:Col3a1 UTSW 1 45330541 splice site probably benign
R0122:Col3a1 UTSW 1 45340897 intron probably benign
R0131:Col3a1 UTSW 1 45328868 splice site probably benign
R0762:Col3a1 UTSW 1 45321526 missense unknown
R0765:Col3a1 UTSW 1 45336651 unclassified probably benign
R0853:Col3a1 UTSW 1 45343324 intron probably benign
R0898:Col3a1 UTSW 1 45333993 unclassified probably benign
R1170:Col3a1 UTSW 1 45327601 missense unknown
R1170:Col3a1 UTSW 1 45347724 missense probably damaging 1.00
R1440:Col3a1 UTSW 1 45343312 splice site probably null
R1449:Col3a1 UTSW 1 45321611 missense unknown
R1526:Col3a1 UTSW 1 45321688 missense unknown
R1572:Col3a1 UTSW 1 45345968 missense possibly damaging 0.95
R1585:Col3a1 UTSW 1 45327866 splice site probably null
R1616:Col3a1 UTSW 1 45328488 critical splice donor site probably null
R1691:Col3a1 UTSW 1 45348616 unclassified probably benign
R1876:Col3a1 UTSW 1 45342235 splice site probably null
R1937:Col3a1 UTSW 1 45334293 unclassified probably benign
R2093:Col3a1 UTSW 1 45332990 missense probably damaging 1.00
R2110:Col3a1 UTSW 1 45330145 missense unknown
R2119:Col3a1 UTSW 1 45346121 missense probably damaging 1.00
R2256:Col3a1 UTSW 1 45321632 missense unknown
R2327:Col3a1 UTSW 1 45338611 unclassified probably benign
R2518:Col3a1 UTSW 1 45337512 unclassified probably benign
R2991:Col3a1 UTSW 1 45335779 unclassified probably benign
R3405:Col3a1 UTSW 1 45338753 unclassified probably benign
R3784:Col3a1 UTSW 1 45347135 missense probably damaging 1.00
R3847:Col3a1 UTSW 1 45321990 missense unknown
R3848:Col3a1 UTSW 1 45321990 missense unknown
R3849:Col3a1 UTSW 1 45321990 missense unknown
R4502:Col3a1 UTSW 1 45348677 unclassified probably benign
R4503:Col3a1 UTSW 1 45348677 unclassified probably benign
R4764:Col3a1 UTSW 1 45346110 missense probably damaging 1.00
R4839:Col3a1 UTSW 1 45323803 splice site probably null
R4934:Col3a1 UTSW 1 45339952 unclassified probably benign
R5033:Col3a1 UTSW 1 45346110 missense probably damaging 1.00
R5123:Col3a1 UTSW 1 45333596 unclassified probably benign
R5190:Col3a1 UTSW 1 45329084 missense unknown
R5190:Col3a1 UTSW 1 45344807 intron probably benign
R5375:Col3a1 UTSW 1 45347899 unclassified probably null
R5407:Col3a1 UTSW 1 45346052 missense probably benign 0.03
R5627:Col3a1 UTSW 1 45331560 unclassified probably benign
R5642:Col3a1 UTSW 1 45331712 unclassified probably benign
R6014:Col3a1 UTSW 1 45321579 nonsense probably null
R6052:Col3a1 UTSW 1 45345013 unclassified probably benign
R6263:Col3a1 UTSW 1 45321575 missense unknown
R6453:Col3a1 UTSW 1 45339378 unclassified probably benign
R6463:Col3a1 UTSW 1 45342205 intron probably benign
R6488:Col3a1 UTSW 1 45331534 unclassified probably benign
R6525:Col3a1 UTSW 1 45347179 missense possibly damaging 0.88
R6637:Col3a1 UTSW 1 45347730 missense probably damaging 1.00
R6704:Col3a1 UTSW 1 45347732 missense probably damaging 1.00
R6744:Col3a1 UTSW 1 45338622 unclassified probably benign
R6747:Col3a1 UTSW 1 45338622 unclassified probably benign
R6858:Col3a1 UTSW 1 45345984 missense probably damaging 1.00
R6903:Col3a1 UTSW 1 45331988 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCGTGATAGTTCTACAGTGACC -3'
(R):5'- GTGTTGAGAGTATGATGAAAATGCC -3'

Sequencing Primer
(F):5'- GCAAGGAATGGATACCATAATGTATC -3'
(R):5'- ATGCCTTTAATACTTACAGGGCCAC -3'
Posted On2018-08-01