Incidental Mutation 'R6745:Ly75'
ID530519
Institutional Source Beutler Lab
Gene Symbol Ly75
Ensembl Gene ENSMUSG00000026980
Gene Namelymphocyte antigen 75
SynonymsDEC-205, CD205
MMRRC Submission
Accession Numbers

Genbank: NM_013825

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6745 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location60292103-60383303 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 60308179 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 1448 (R1448L)
Ref Sequence ENSEMBL: ENSMUSP00000028362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028362] [ENSMUST00000112533]
Predicted Effect probably damaging
Transcript: ENSMUST00000028362
AA Change: R1448L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028362
Gene: ENSMUSG00000026980
AA Change: R1448L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112533
AA Change: R1448L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108152
Gene: ENSMUSG00000026980
AA Change: R1448L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display abnormalities in CD8-positive T cell morphology and cytotoxic T cell physiology. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb G T 10: 10,390,197 T1040K probably damaging Het
Adgrf3 A G 5: 30,203,603 V59A probably benign Het
Ankk1 G T 9: 49,416,180 H566Q probably benign Het
Avil A C 10: 127,014,119 D613A probably benign Het
Bbs9 A G 9: 22,670,836 N613S probably benign Het
Chd1 A G 17: 17,387,167 T326A probably benign Het
Clasp2 A T 9: 113,875,270 R558* probably null Het
Cmbl A G 15: 31,589,787 D221G possibly damaging Het
Col3a1 G T 1: 45,338,622 probably benign Het
Creb5 A T 6: 53,604,532 M172L probably benign Het
Crybg3 A G 16: 59,552,244 V2291A possibly damaging Het
Cyp2g1 T G 7: 26,814,179 V181G probably damaging Het
D430042O09Rik T C 7: 125,770,650 S137P probably benign Het
Dclk1 T A 3: 55,477,808 S40T probably damaging Het
Dnah10 G T 5: 124,808,812 M3053I probably damaging Het
Dnah12 T A 14: 26,707,228 I268K probably damaging Het
Dock2 C G 11: 34,705,842 D396H probably damaging Het
Dock2 T A 11: 34,705,843 K395N probably damaging Het
Gpbp1 G A 13: 111,453,385 R59C probably benign Het
Ifi47 T G 11: 49,095,502 I32S probably benign Het
Ighg3 A G 12: 113,360,270 V166A unknown Het
Kdm5d T A Y: 927,112 C617S probably benign Homo
Kif20b T G 19: 34,928,876 S55A possibly damaging Het
Klhl1 C T 14: 96,280,002 probably null Het
Kndc1 C T 7: 139,920,976 T727I probably benign Het
Lrrk1 A T 7: 66,273,001 I298N probably damaging Het
Mup4 C T 4: 59,960,091 V58M possibly damaging Het
Nr2c1 T C 10: 94,190,664 F467S probably damaging Het
Olfr112 T A 17: 37,563,579 H244L probably damaging Het
Pla2g4a G T 1: 149,886,230 Q151K probably benign Het
Pom121l2 A T 13: 21,983,698 Q713L probably benign Het
Pomgnt1 T A 4: 116,153,883 S210T probably damaging Het
Prb1 T C 6: 132,209,420 probably null Het
Pyroxd2 T C 19: 42,747,360 D101G probably damaging Het
Ranbp3 A G 17: 56,709,308 D359G probably benign Het
Rgsl1 T A 1: 153,822,317 I531F probably benign Het
Serpina1b T C 12: 103,730,355 N265S possibly damaging Het
Slc51b T C 9: 65,412,930 E85G possibly damaging Het
Stk32c T A 7: 139,122,893 R195W probably damaging Het
Uggt2 T C 14: 119,042,610 T819A possibly damaging Het
Ugt1a9 A T 1: 88,071,176 E116V probably benign Het
Zswim5 C G 4: 116,975,204 P543A probably damaging Het
Other mutations in Ly75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Ly75 APN 2 60376077 missense probably damaging 1.00
IGL01072:Ly75 APN 2 60354496 missense probably damaging 1.00
IGL01409:Ly75 APN 2 60321692 splice site probably null
IGL01432:Ly75 APN 2 60376007 missense probably damaging 1.00
IGL01626:Ly75 APN 2 60301015 missense probably benign 0.13
IGL01690:Ly75 APN 2 60338311 missense probably damaging 1.00
IGL01862:Ly75 APN 2 60299172 missense probably damaging 1.00
IGL01982:Ly75 APN 2 60311764 missense probably damaging 1.00
IGL02075:Ly75 APN 2 60352356 missense probably damaging 0.99
IGL02338:Ly75 APN 2 60354452 missense probably benign 0.04
IGL02364:Ly75 APN 2 60358507 missense probably damaging 1.00
IGL02456:Ly75 APN 2 60293781 missense probably benign 0.09
IGL02474:Ly75 APN 2 60383182 missense probably null 1.00
IGL02608:Ly75 APN 2 60321900 missense probably benign 0.41
IGL02986:Ly75 APN 2 60308191 missense probably damaging 1.00
IGL03015:Ly75 APN 2 60376160 missense probably damaging 1.00
IGL03049:Ly75 APN 2 60352070 missense probably damaging 0.99
euphues UTSW 2 60299045 critical splice donor site probably null
four_score UTSW 2 60311771 missense possibly damaging 0.75
lyly UTSW 2 60327873 missense possibly damaging 0.49
Witty UTSW 2 60354500 missense probably damaging 1.00
D605:Ly75 UTSW 2 60352352 critical splice donor site probably null
R0046:Ly75 UTSW 2 60339457 intron probably benign
R0055:Ly75 UTSW 2 60321918 missense probably benign 0.01
R0055:Ly75 UTSW 2 60321918 missense probably benign 0.01
R0071:Ly75 UTSW 2 60321819 missense probably benign 0.01
R0071:Ly75 UTSW 2 60321819 missense probably benign 0.01
R0285:Ly75 UTSW 2 60318319 missense probably damaging 1.00
R0387:Ly75 UTSW 2 60306404 missense probably benign 0.20
R0492:Ly75 UTSW 2 60308276 missense probably damaging 1.00
R0688:Ly75 UTSW 2 60316221 missense probably benign 0.41
R1367:Ly75 UTSW 2 60293758 unclassified probably null
R1463:Ly75 UTSW 2 60368757 critical splice donor site probably null
R1581:Ly75 UTSW 2 60327893 missense probably damaging 1.00
R1663:Ly75 UTSW 2 60314234 missense probably damaging 1.00
R1818:Ly75 UTSW 2 60311777 missense probably damaging 1.00
R1881:Ly75 UTSW 2 60349940 missense probably benign 0.00
R2244:Ly75 UTSW 2 60349913 missense probably benign 0.01
R2905:Ly75 UTSW 2 60334554 missense probably benign 0.00
R3967:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R3968:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R4039:Ly75 UTSW 2 60352995 missense probably damaging 1.00
R4406:Ly75 UTSW 2 60354550 missense probably damaging 1.00
R4526:Ly75 UTSW 2 60330773 missense probably benign 0.09
R4647:Ly75 UTSW 2 60308278 missense probably damaging 1.00
R4795:Ly75 UTSW 2 60349940 missense probably benign 0.00
R4796:Ly75 UTSW 2 60349940 missense probably benign 0.00
R4962:Ly75 UTSW 2 60352125 missense probably damaging 1.00
R4979:Ly75 UTSW 2 60375894 missense probably damaging 1.00
R5072:Ly75 UTSW 2 60375963 missense probably damaging 1.00
R5288:Ly75 UTSW 2 60303641 missense probably damaging 1.00
R5373:Ly75 UTSW 2 60311771 missense possibly damaging 0.75
R5374:Ly75 UTSW 2 60311771 missense possibly damaging 0.75
R5384:Ly75 UTSW 2 60334487 nonsense probably null
R5385:Ly75 UTSW 2 60303641 missense probably damaging 1.00
R5395:Ly75 UTSW 2 60365111 missense probably benign 0.41
R5531:Ly75 UTSW 2 60365145 missense probably damaging 0.98
R5662:Ly75 UTSW 2 60352381 missense probably damaging 1.00
R5667:Ly75 UTSW 2 60308311 missense probably damaging 1.00
R5668:Ly75 UTSW 2 60354500 missense probably damaging 1.00
R5671:Ly75 UTSW 2 60308311 missense probably damaging 1.00
R5677:Ly75 UTSW 2 60299082 missense probably benign 0.00
R5764:Ly75 UTSW 2 60318439 missense probably benign
R5896:Ly75 UTSW 2 60383146 missense probably benign
R6025:Ly75 UTSW 2 60375962 missense probably damaging 1.00
R6113:Ly75 UTSW 2 60368873 missense probably benign 0.04
R6448:Ly75 UTSW 2 60299045 critical splice donor site probably null
R6601:Ly75 UTSW 2 60318376 missense probably benign 0.11
R6955:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R6960:Ly75 UTSW 2 60306405 missense probably benign
R7100:Ly75 UTSW 2 60306434 missense probably benign
R7110:Ly75 UTSW 2 60376184 missense probably benign 0.31
R7203:Ly75 UTSW 2 60323852 nonsense probably null
R7291:Ly75 UTSW 2 60329993 missense probably damaging 0.98
R7308:Ly75 UTSW 2 60334515 missense probably benign 0.04
X0025:Ly75 UTSW 2 60354475 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCTGTGAACCCGAGATGG -3'
(R):5'- TACAGTTGACTATGAGGACAAACAC -3'

Sequencing Primer
(F):5'- CTGGGTCAGTTGCATTCTATAATTC -3'
(R):5'- TTGACTATGAGGACAAACACAATGGC -3'
Posted On2018-08-01