Incidental Mutation 'R6745:Zswim5'
ID530523
Institutional Source Beutler Lab
Gene Symbol Zswim5
Ensembl Gene ENSMUSG00000033948
Gene Namezinc finger SWIM-type containing 5
Synonyms4933426E21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.436) question?
Stock #R6745 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location116877376-116989264 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 116975204 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 543 (P543A)
Ref Sequence ENSEMBL: ENSMUSP00000049474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044823]
Predicted Effect probably damaging
Transcript: ENSMUST00000044823
AA Change: P543A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049474
Gene: ENSMUSG00000033948
AA Change: P543A

DomainStartEndE-ValueType
low complexity region 35 56 N/A INTRINSIC
low complexity region 119 182 N/A INTRINSIC
low complexity region 692 708 N/A INTRINSIC
low complexity region 982 995 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb G T 10: 10,390,197 T1040K probably damaging Het
Adgrf3 A G 5: 30,203,603 V59A probably benign Het
Ankk1 G T 9: 49,416,180 H566Q probably benign Het
Avil A C 10: 127,014,119 D613A probably benign Het
Bbs9 A G 9: 22,670,836 N613S probably benign Het
Chd1 A G 17: 17,387,167 T326A probably benign Het
Clasp2 A T 9: 113,875,270 R558* probably null Het
Cmbl A G 15: 31,589,787 D221G possibly damaging Het
Col3a1 G T 1: 45,338,622 probably benign Het
Creb5 A T 6: 53,604,532 M172L probably benign Het
Crybg3 A G 16: 59,552,244 V2291A possibly damaging Het
Cyp2g1 T G 7: 26,814,179 V181G probably damaging Het
D430042O09Rik T C 7: 125,770,650 S137P probably benign Het
Dclk1 T A 3: 55,477,808 S40T probably damaging Het
Dnah10 G T 5: 124,808,812 M3053I probably damaging Het
Dnah12 T A 14: 26,707,228 I268K probably damaging Het
Dock2 C G 11: 34,705,842 D396H probably damaging Het
Dock2 T A 11: 34,705,843 K395N probably damaging Het
Gpbp1 G A 13: 111,453,385 R59C probably benign Het
Ifi47 T G 11: 49,095,502 I32S probably benign Het
Ighg3 A G 12: 113,360,270 V166A unknown Het
Kdm5d T A Y: 927,112 C617S probably benign Homo
Kif20b T G 19: 34,928,876 S55A possibly damaging Het
Klhl1 C T 14: 96,280,002 probably null Het
Kndc1 C T 7: 139,920,976 T727I probably benign Het
Lrrk1 A T 7: 66,273,001 I298N probably damaging Het
Ly75 C A 2: 60,308,179 R1448L probably damaging Het
Mup4 C T 4: 59,960,091 V58M possibly damaging Het
Nr2c1 T C 10: 94,190,664 F467S probably damaging Het
Olfr112 T A 17: 37,563,579 H244L probably damaging Het
Pla2g4a G T 1: 149,886,230 Q151K probably benign Het
Pom121l2 A T 13: 21,983,698 Q713L probably benign Het
Pomgnt1 T A 4: 116,153,883 S210T probably damaging Het
Prb1 T C 6: 132,209,420 probably null Het
Pyroxd2 T C 19: 42,747,360 D101G probably damaging Het
Ranbp3 A G 17: 56,709,308 D359G probably benign Het
Rgsl1 T A 1: 153,822,317 I531F probably benign Het
Serpina1b T C 12: 103,730,355 N265S possibly damaging Het
Slc51b T C 9: 65,412,930 E85G possibly damaging Het
Stk32c T A 7: 139,122,893 R195W probably damaging Het
Uggt2 T C 14: 119,042,610 T819A possibly damaging Het
Ugt1a9 A T 1: 88,071,176 E116V probably benign Het
Other mutations in Zswim5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Zswim5 APN 4 116985736 missense possibly damaging 0.93
IGL01700:Zswim5 APN 4 116986461 unclassified probably benign
IGL01975:Zswim5 APN 4 116965692 missense probably benign 0.03
IGL02334:Zswim5 APN 4 116986644 missense probably damaging 1.00
IGL02505:Zswim5 APN 4 116962552 missense probably benign 0.43
IGL02712:Zswim5 APN 4 116985695 missense probably damaging 0.99
PIT4243001:Zswim5 UTSW 4 116984778 missense probably benign 0.10
R0324:Zswim5 UTSW 4 116986906 missense probably damaging 1.00
R0611:Zswim5 UTSW 4 116986677 unclassified probably null
R0730:Zswim5 UTSW 4 116985746 missense possibly damaging 0.75
R1663:Zswim5 UTSW 4 116986895 missense probably damaging 1.00
R1843:Zswim5 UTSW 4 116877699 missense unknown
R2070:Zswim5 UTSW 4 116979912 missense probably benign 0.14
R2176:Zswim5 UTSW 4 116973041 missense probably damaging 0.99
R3715:Zswim5 UTSW 4 116962558 missense probably benign 0.21
R4044:Zswim5 UTSW 4 116986702 missense probably damaging 1.00
R4063:Zswim5 UTSW 4 116877980 missense unknown
R4118:Zswim5 UTSW 4 116986819 missense possibly damaging 0.93
R4612:Zswim5 UTSW 4 116986704 missense probably damaging 1.00
R4782:Zswim5 UTSW 4 116972972 missense probably benign 0.00
R4799:Zswim5 UTSW 4 116972972 missense probably benign 0.00
R4983:Zswim5 UTSW 4 116985686 missense possibly damaging 0.60
R5294:Zswim5 UTSW 4 116979577 missense possibly damaging 0.93
R5836:Zswim5 UTSW 4 116984803 missense probably benign 0.27
R6025:Zswim5 UTSW 4 116950909 missense probably damaging 1.00
R6041:Zswim5 UTSW 4 116962621 missense probably benign 0.01
R6042:Zswim5 UTSW 4 116962621 missense probably benign 0.01
R6043:Zswim5 UTSW 4 116962621 missense probably benign 0.01
R6159:Zswim5 UTSW 4 116979679 missense probably damaging 1.00
R6198:Zswim5 UTSW 4 116878007 missense probably benign 0.13
R6415:Zswim5 UTSW 4 116980866 missense possibly damaging 0.89
R6442:Zswim5 UTSW 4 116951005 missense probably damaging 1.00
R6547:Zswim5 UTSW 4 116986903 missense probably damaging 1.00
R6616:Zswim5 UTSW 4 116986741 missense possibly damaging 0.93
R7144:Zswim5 UTSW 4 116975976 critical splice donor site probably null
R7260:Zswim5 UTSW 4 116962646 missense probably damaging 1.00
R7300:Zswim5 UTSW 4 116975905 missense probably damaging 1.00
R7310:Zswim5 UTSW 4 116984688 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGTATATCCCATCACACTGAGGC -3'
(R):5'- TGAGACCCCAGGATGTTAGAGG -3'

Sequencing Primer
(F):5'- AGGAGCCCTTTCAAGATGGCTTC -3'
(R):5'- ACCCCAGGATGTTAGAGGATTCC -3'
Posted On2018-08-01