Incidental Mutation 'R6745:Pyroxd2'
ID530556
Institutional Source Beutler Lab
Gene Symbol Pyroxd2
Ensembl Gene ENSMUSG00000060224
Gene Namepyridine nucleotide-disulphide oxidoreductase domain 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6745 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location42725858-42752775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42747360 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 101 (D101G)
Ref Sequence ENSEMBL: ENSMUSP00000075825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076505]
Predicted Effect probably damaging
Transcript: ENSMUST00000076505
AA Change: D101G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075825
Gene: ENSMUSG00000060224
AA Change: D101G

DomainStartEndE-ValueType
Pfam:NAD_binding_8 39 97 3.5e-11 PFAM
Pfam:Amino_oxidase 46 423 2.7e-15 PFAM
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb G T 10: 10,390,197 T1040K probably damaging Het
Adgrf3 A G 5: 30,203,603 V59A probably benign Het
Ankk1 G T 9: 49,416,180 H566Q probably benign Het
Avil A C 10: 127,014,119 D613A probably benign Het
Bbs9 A G 9: 22,670,836 N613S probably benign Het
Chd1 A G 17: 17,387,167 T326A probably benign Het
Clasp2 A T 9: 113,875,270 R558* probably null Het
Cmbl A G 15: 31,589,787 D221G possibly damaging Het
Col3a1 G T 1: 45,338,622 probably benign Het
Creb5 A T 6: 53,604,532 M172L probably benign Het
Crybg3 A G 16: 59,552,244 V2291A possibly damaging Het
Cyp2g1 T G 7: 26,814,179 V181G probably damaging Het
D430042O09Rik T C 7: 125,770,650 S137P probably benign Het
Dclk1 T A 3: 55,477,808 S40T probably damaging Het
Dnah10 G T 5: 124,808,812 M3053I probably damaging Het
Dnah12 T A 14: 26,707,228 I268K probably damaging Het
Dock2 C G 11: 34,705,842 D396H probably damaging Het
Dock2 T A 11: 34,705,843 K395N probably damaging Het
Gpbp1 G A 13: 111,453,385 R59C probably benign Het
Ifi47 T G 11: 49,095,502 I32S probably benign Het
Ighg3 A G 12: 113,360,270 V166A unknown Het
Kdm5d T A Y: 927,112 C617S probably benign Homo
Kif20b T G 19: 34,928,876 S55A possibly damaging Het
Klhl1 C T 14: 96,280,002 probably null Het
Kndc1 C T 7: 139,920,976 T727I probably benign Het
Lrrk1 A T 7: 66,273,001 I298N probably damaging Het
Ly75 C A 2: 60,308,179 R1448L probably damaging Het
Mup4 C T 4: 59,960,091 V58M possibly damaging Het
Nr2c1 T C 10: 94,190,664 F467S probably damaging Het
Olfr112 T A 17: 37,563,579 H244L probably damaging Het
Pla2g4a G T 1: 149,886,230 Q151K probably benign Het
Pom121l2 A T 13: 21,983,698 Q713L probably benign Het
Pomgnt1 T A 4: 116,153,883 S210T probably damaging Het
Prb1 T C 6: 132,209,420 probably null Het
Ranbp3 A G 17: 56,709,308 D359G probably benign Het
Rgsl1 T A 1: 153,822,317 I531F probably benign Het
Serpina1b T C 12: 103,730,355 N265S possibly damaging Het
Slc51b T C 9: 65,412,930 E85G possibly damaging Het
Stk32c T A 7: 139,122,893 R195W probably damaging Het
Uggt2 T C 14: 119,042,610 T819A possibly damaging Het
Ugt1a9 A T 1: 88,071,176 E116V probably benign Het
Zswim5 C G 4: 116,975,204 P543A probably damaging Het
Other mutations in Pyroxd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Pyroxd2 APN 19 42731438 missense possibly damaging 0.89
IGL01636:Pyroxd2 APN 19 42738332 missense probably benign 0.40
IGL02808:Pyroxd2 APN 19 42731342 missense probably benign
IGL02831:Pyroxd2 APN 19 42735903 missense probably damaging 0.99
IGL03179:Pyroxd2 APN 19 42747562 missense possibly damaging 0.89
PIT4486001:Pyroxd2 UTSW 19 42740389 missense probably benign 0.00
R0360:Pyroxd2 UTSW 19 42747553 missense probably damaging 1.00
R0364:Pyroxd2 UTSW 19 42747553 missense probably damaging 1.00
R0567:Pyroxd2 UTSW 19 42735925 missense probably benign
R0690:Pyroxd2 UTSW 19 42727642 splice site probably benign
R0843:Pyroxd2 UTSW 19 42747547 missense probably damaging 1.00
R1649:Pyroxd2 UTSW 19 42738134 missense probably damaging 0.99
R2032:Pyroxd2 UTSW 19 42727649 splice site probably benign
R2087:Pyroxd2 UTSW 19 42733770 missense probably benign 0.00
R3040:Pyroxd2 UTSW 19 42735518 missense probably benign
R3898:Pyroxd2 UTSW 19 42740392 missense probably damaging 0.99
R4746:Pyroxd2 UTSW 19 42752400 nonsense probably null
R5394:Pyroxd2 UTSW 19 42740459 missense probably benign
R5634:Pyroxd2 UTSW 19 42740485 missense probably benign 0.21
R5977:Pyroxd2 UTSW 19 42735472 missense probably damaging 1.00
R7128:Pyroxd2 UTSW 19 42731403 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- TTAAAGCACAGGGTGGCTG -3'
(R):5'- ATCAAGAAAGGACCCTGTGTC -3'

Sequencing Primer
(F):5'- TGGCTGAGACAAAAATCAAGCTATG -3'
(R):5'- AGCGTACCTCCAGAGACTG -3'
Posted On2018-08-01