Incidental Mutation 'R6747:Peg10'
ID530579
Institutional Source Beutler Lab
Gene Symbol Peg10
Ensembl Gene ENSMUSG00000092035
Gene Namepaternally expressed 10
SynonymsHB-1, MyEF-3, Mart2, Mar2, MyEF-3 like, MEF3L, Edr
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6747 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location4747306-4760517 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to G at 4757137 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166678] [ENSMUST00000176204] [ENSMUST00000176551]
Predicted Effect unknown
Transcript: ENSMUST00000166678
AA Change: Q972R
SMART Domains Protein: ENSMUSP00000127306
Gene: ENSMUSG00000092035
AA Change: Q972R

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:DUF4939 130 220 6.1e-17 PFAM
Pfam:Retrotrans_gag 174 267 2.9e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
low complexity region 368 379 N/A INTRINSIC
low complexity region 541 610 N/A INTRINSIC
low complexity region 621 660 N/A INTRINSIC
low complexity region 663 785 N/A INTRINSIC
Blast:SERPIN 798 910 1e-5 BLAST
low complexity region 923 936 N/A INTRINSIC
low complexity region 972 998 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176204
SMART Domains Protein: ENSMUSP00000134963
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:Retrotrans_gag 174 267 1.3e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000176551
AA Change: Q571R
SMART Domains Protein: ENSMUSP00000135076
Gene: ENSMUSG00000092035
AA Change: Q571R

DomainStartEndE-ValueType
low complexity region 173 242 N/A INTRINSIC
low complexity region 253 292 N/A INTRINSIC
low complexity region 295 417 N/A INTRINSIC
Blast:SERPIN 430 542 6e-6 BLAST
low complexity region 555 568 N/A INTRINSIC
low complexity region 604 630 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: This is a paternally expressed imprinted gene that is thought to have been derived from the Ty3/Gypsy family of retrotransposons. It contains two overlapping open reading frames, RF1 and RF2, and expresses two proteins: a shorter, gag-like protein (with a CCHC-type zinc finger domain) from RF1; and a longer, gag/pol-like fusion protein (with an additional aspartic protease motif) from RF1/RF2 by -1 translational frameshifting (-1 FS). While -1 FS has been observed in RNA viruses and transposons in both prokaryotes and eukaryotes, this gene represents the first example of -1 FS in a eukaryotic cellular gene. This gene is highly conserved across mammalian species and retains the heptanucleotide (GGGAAAC) and pseudoknot elements required for -1 FS. It is expressed in adult and embryonic tissues (most notably in placenta) and reported to have a role in cell proliferation, differentiation, apoptosis and cancer development. Knockout mice lacking this gene showed early embryonic lethality with placental defects, indicating the importance of this gene in embryonic development. [provided by RefSeq, Oct 2014]
PHENOTYPE: Heterozygous mice with a paternally inherited null allele display embryonic lethality during organogenesis with abnormal placental development. Heterozygous mice with a maternally inherited null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 122,126,313 probably null Het
Acyp1 C T 12: 85,278,905 V107I probably null Het
Aftph T C 11: 20,726,144 probably null Het
Agtpbp1 A T 13: 59,544,353 probably null Het
Arhgap15 C A 2: 44,116,677 P269T probably damaging Het
Arhgap30 T C 1: 171,407,729 V557A probably damaging Het
Asb3 T A 11: 31,081,493 M410K probably benign Het
B4galnt2 T C 11: 95,868,634 probably null Het
Birc3 A G 9: 7,860,261 probably null Het
Cav2 A T 6: 17,286,951 N69Y probably damaging Het
Cc2d2b G A 19: 40,795,667 C826Y probably benign Het
Cenpf T A 1: 189,652,854 T2410S probably benign Het
Chchd1 A G 14: 20,703,380 D24G probably benign Het
Cmip G A 8: 117,436,879 G450S probably benign Het
Col11a1 C T 3: 114,212,450 Q534* probably null Het
Col3a1 G T 1: 45,338,622 probably benign Het
Cox4i1 T C 8: 120,673,230 I31T possibly damaging Het
Cstf3 G T 2: 104,646,767 V168F probably damaging Het
Dapk1 T C 13: 60,725,340 I352T probably benign Het
Ddx52 T C 11: 83,955,302 V456A probably damaging Het
Dmxl2 A T 9: 54,416,088 H1337Q probably damaging Het
Dnah7a T C 1: 53,636,062 T369A probably benign Het
Dppa1 T A 11: 46,625,595 I8F unknown Het
Ebf1 G T 11: 44,883,814 V213F probably damaging Het
Foxb2 C A 19: 16,872,833 E270* probably null Het
Gclc A T 9: 77,788,245 R450W probably damaging Het
Gm13128 T C 4: 144,332,978 W420R probably benign Het
Grin2d T C 7: 45,862,268 E251G probably damaging Het
Hal A T 10: 93,500,677 N423Y probably damaging Het
Krtap4-8 T A 11: 99,780,091 I185F unknown Het
Lrp3 T A 7: 35,211,437 Q61L probably benign Het
Met A C 6: 17,571,467 Q1296H probably damaging Het
Mphosph9 T A 5: 124,297,699 N557I possibly damaging Het
Mrpl46 C A 7: 78,782,981 W16C probably benign Het
Myh13 G A 11: 67,350,419 R874Q probably damaging Het
Nelfb G A 2: 25,203,381 T453I probably benign Het
Nos2 A G 11: 78,952,954 D909G probably damaging Het
Nr5a2 T C 1: 136,882,344 E431G possibly damaging Het
Nsmce2 A G 15: 59,591,724 D149G probably benign Het
Olfr203 T C 16: 59,303,641 F164L probably benign Het
Olfr690 C T 7: 105,330,027 R55H probably benign Het
Pcbp4 C A 9: 106,460,648 probably null Het
Pms2 C T 5: 143,925,419 P154L probably benign Het
Pou6f2 A C 13: 18,129,187 L112R probably benign Het
Prdm6 A T 18: 53,465,046 probably benign Het
Prob1 G A 18: 35,655,154 R12W probably damaging Het
Rif1 T A 2: 52,078,263 probably null Het
Rpl9-ps6 A G 19: 32,466,143 S137P probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Homo
Sec23ip A G 7: 128,752,849 silent Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Slc39a8 T C 3: 135,849,180 probably null Het
Slc6a18 C A 13: 73,677,991 probably benign Het
Snw1 T C 12: 87,464,710 D57G probably damaging Het
Sox6 C G 7: 115,541,731 R505P probably damaging Het
Speg T C 1: 75,410,395 probably null Het
Spire2 C T 8: 123,356,846 R190C probably damaging Het
Stard9 A C 2: 120,698,383 H1707P possibly damaging Het
Tenm3 G T 8: 48,343,243 T237K probably damaging Het
Themis2 T A 4: 132,796,262 E31V possibly damaging Het
Trim56 T G 5: 137,114,521 Q47P probably damaging Het
Trim58 T C 11: 58,651,264 I350T probably benign Het
Ttll7 C T 3: 146,944,056 P639S probably benign Het
Ubxn6 A G 17: 56,070,650 probably null Het
Vmn2r114 A T 17: 23,309,876 F417L probably benign Het
Vmn2r29 T A 7: 7,231,422 M822L probably benign Het
Vps9d1 T C 8: 123,254,007 D27G probably damaging Het
Wdr3 C T 3: 100,138,724 R931Q probably damaging Het
Whamm G A 7: 81,578,302 probably null Het
Zcchc24 T C 14: 25,757,033 H142R probably damaging Het
Zfp292 T C 4: 34,806,894 K2050R probably damaging Het
Other mutations in Peg10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02029:Peg10 APN 6 4754473 utr 5 prime probably benign
IGL03063:Peg10 APN 6 4756647 utr 3 prime probably benign
piaggio UTSW 6 4756427 utr 3 prime probably benign
R0090:Peg10 UTSW 6 4756063 utr 3 prime probably benign
R0148:Peg10 UTSW 6 4755711 missense possibly damaging 0.88
R0650:Peg10 UTSW 6 4756475 small insertion probably benign
R0698:Peg10 UTSW 6 4756835 utr 3 prime probably benign
R1600:Peg10 UTSW 6 4757080 utr 3 prime probably benign
R1842:Peg10 UTSW 6 4756381 utr 3 prime probably benign
R1930:Peg10 UTSW 6 4755778 missense probably damaging 0.99
R1931:Peg10 UTSW 6 4755778 missense probably damaging 0.99
R2162:Peg10 UTSW 6 4755914 utr 3 prime probably benign
R2215:Peg10 UTSW 6 4756918 utr 3 prime probably benign
R2339:Peg10 UTSW 6 4756102 utr 3 prime probably benign
R2847:Peg10 UTSW 6 4756912 utr 3 prime probably benign
R2848:Peg10 UTSW 6 4756912 utr 3 prime probably benign
R3000:Peg10 UTSW 6 4754276 utr 5 prime probably benign
R3056:Peg10 UTSW 6 4755029 missense possibly damaging 0.66
R4051:Peg10 UTSW 6 4754534 missense probably benign 0.00
R4059:Peg10 UTSW 6 4756427 utr 3 prime probably benign
R4296:Peg10 UTSW 6 4756472 small insertion probably benign
R4626:Peg10 UTSW 6 4756460 small insertion probably benign
R4634:Peg10 UTSW 6 4756452 small insertion probably benign
R4679:Peg10 UTSW 6 4756452 small insertion probably benign
R4834:Peg10 UTSW 6 4754294 utr 5 prime probably benign
R4982:Peg10 UTSW 6 4756451 small insertion probably benign
R4983:Peg10 UTSW 6 4756451 small insertion probably benign
R4996:Peg10 UTSW 6 4756454 small insertion probably benign
R4997:Peg10 UTSW 6 4756457 small insertion probably benign
R5015:Peg10 UTSW 6 4756453 small insertion probably benign
R5085:Peg10 UTSW 6 4755864 utr 3 prime probably benign
R5091:Peg10 UTSW 6 4754511 missense probably benign 0.01
R5231:Peg10 UTSW 6 4756939 utr 3 prime probably benign
R5278:Peg10 UTSW 6 4756442 small deletion probably benign
R5364:Peg10 UTSW 6 4756128 utr 3 prime probably benign
R5397:Peg10 UTSW 6 4756453 small insertion probably benign
R5485:Peg10 UTSW 6 4755565 missense probably benign 0.09
R5573:Peg10 UTSW 6 4755913 utr 3 prime probably benign
R5710:Peg10 UTSW 6 4756350 small insertion probably benign
R5710:Peg10 UTSW 6 4756351 small insertion probably benign
R5736:Peg10 UTSW 6 4754423 missense probably benign 0.00
R5865:Peg10 UTSW 6 4754375 missense probably damaging 0.98
R6056:Peg10 UTSW 6 4756449 small insertion probably benign
R6116:Peg10 UTSW 6 4756351 small insertion probably benign
R6129:Peg10 UTSW 6 4756449 small insertion probably benign
R6147:Peg10 UTSW 6 4754499 start gained probably benign
R6171:Peg10 UTSW 6 4756449 small insertion probably benign
R6194:Peg10 UTSW 6 4756351 small insertion probably benign
R6197:Peg10 UTSW 6 4756452 small insertion probably benign
R6207:Peg10 UTSW 6 4756449 small insertion probably benign
R6215:Peg10 UTSW 6 4756452 small insertion probably benign
R6276:Peg10 UTSW 6 4756449 small insertion probably benign
R6281:Peg10 UTSW 6 4756449 small insertion probably benign
R6287:Peg10 UTSW 6 4756451 small insertion probably benign
R6302:Peg10 UTSW 6 4756449 small insertion probably benign
R6393:Peg10 UTSW 6 4756452 small insertion probably benign
R6394:Peg10 UTSW 6 4756451 small insertion probably benign
R6405:Peg10 UTSW 6 4756453 small insertion probably benign
R6421:Peg10 UTSW 6 4756449 small insertion probably benign
R6486:Peg10 UTSW 6 4756449 small insertion probably benign
R6538:Peg10 UTSW 6 4756449 small insertion probably benign
R6668:Peg10 UTSW 6 4754502 missense probably benign 0.01
R6679:Peg10 UTSW 6 4754276 utr 5 prime probably benign
R6685:Peg10 UTSW 6 4754738 missense probably damaging 1.00
R6702:Peg10 UTSW 6 4756452 small insertion probably benign
R6706:Peg10 UTSW 6 4756452 small insertion probably benign
R6775:Peg10 UTSW 6 4756452 small insertion probably benign
R6811:Peg10 UTSW 6 4756451 small insertion probably benign
R6823:Peg10 UTSW 6 4756431
R6826:Peg10 UTSW 6 4756353 small insertion probably benign
R6847:Peg10 UTSW 6 4754279 utr 5 prime probably benign
R6861:Peg10 UTSW 6 4756350 small insertion probably benign
R6861:Peg10 UTSW 6 4756351 small insertion probably benign
R6876:Peg10 UTSW 6 4756451 small insertion probably benign
R6882:Peg10 UTSW 6 4756449 small insertion probably benign
R6891:Peg10 UTSW 6 4756449 small insertion probably benign
R6897:Peg10 UTSW 6 4756351 small insertion probably benign
R6911:Peg10 UTSW 6 4756452 small insertion probably benign
R6990:Peg10 UTSW 6 4756451 small insertion probably benign
X0065:Peg10 UTSW 6 4756515 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- GTGGCACCATCCAAAATCAG -3'
(R):5'- CAGTCATAGATTGAGAAGCTGCAC -3'

Sequencing Primer
(F):5'- AATCAGTACCTACGCATGTCTC -3'
(R):5'- AGCTGCACAGGATCAAGTTG -3'
Posted On2018-08-01