Incidental Mutation 'R6750:Crmp1'
ID530686
Institutional Source Beutler Lab
Gene Symbol Crmp1
Ensembl Gene ENSMUSG00000029121
Gene Namecollapsin response mediator protein 1
SynonymsUlip3, DRP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.512) question?
Stock #R6750 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location37241940-37292133 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 37265322 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031004] [ENSMUST00000114158] [ENSMUST00000201834] [ENSMUST00000202434] [ENSMUST00000202652]
Predicted Effect probably null
Transcript: ENSMUST00000031004
SMART Domains Protein: ENSMUSP00000031004
Gene: ENSMUSG00000029121

DomainStartEndE-ValueType
Pfam:Amidohydro_1 64 453 9.1e-35 PFAM
Pfam:Amidohydro_3 333 454 8.5e-10 PFAM
low complexity region 507 530 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114158
SMART Domains Protein: ENSMUSP00000109795
Gene: ENSMUSG00000029121

DomainStartEndE-ValueType
Pfam:Amidohydro_1 178 567 5.2e-34 PFAM
Pfam:Amidohydro_3 448 568 2.8e-10 PFAM
low complexity region 621 644 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201315
Predicted Effect probably null
Transcript: ENSMUST00000201834
SMART Domains Protein: ENSMUSP00000144408
Gene: ENSMUSG00000029121

DomainStartEndE-ValueType
Pfam:Amidohydro_1 1 143 3.6e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202377
Predicted Effect probably null
Transcript: ENSMUST00000202434
SMART Domains Protein: ENSMUSP00000143847
Gene: ENSMUSG00000029121

DomainStartEndE-ValueType
PDB:1KCX|B 128 191 3e-36 PDB
SCOP:d1gkpa1 131 190 2e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000202652
SMART Domains Protein: ENSMUSP00000143895
Gene: ENSMUSG00000029121

DomainStartEndE-ValueType
Pfam:Amidohydro_1 1 155 1.2e-10 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: This gene encodes a protein that is part of the collapsin response mediator protein family. The family is comprised of five, homologous cytosolic phosphoproteins that are expressed in developing and adult nervous tissue and mediate signaling to transduce responses to extracellular cues. This protein is a Semaphorin 3A signaling molecule that regulates collapse of the growth cone. The growth cone mediates axonal pathfinding in neurons. This protein is reported to represent a new class of microtubule-associated proteins. In humans this protein is reported to inhibit cancer cell invasion. In mouse deficiency of this gene may be associated with impaired spatial memory performance. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for one knock-out allele show transient postnatal changes in granule cell proliferation, apoptosis and migration in cerebellum and delayed radial migration of cortical neurons in cerebral cortex. Homozygotes for another knock-out allele show reduced LTP and impaired spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,398 S477T possibly damaging Het
5430419D17Rik T A 7: 131,288,245 probably benign Het
Adal A T 2: 121,142,649 L62F probably damaging Het
Akap13 C T 7: 75,739,458 P2375S probably benign Het
Apob T A 12: 7,997,853 L931Q probably damaging Het
Arcn1 A G 9: 44,750,394 V391A possibly damaging Het
Ccdc162 A T 10: 41,561,226 I1729N possibly damaging Het
Cd24a T C 10: 43,582,725 L86P unknown Het
Churc1 C A 12: 76,775,631 H71Q probably damaging Het
Clcn3 A G 8: 60,914,775 L780P possibly damaging Het
Cldn17 C T 16: 88,506,307 G178E possibly damaging Het
Cmah A G 13: 24,464,252 Y345C probably damaging Het
Cntnap5b C T 1: 100,274,499 S357L probably damaging Het
Col6a6 A G 9: 105,783,680 I410T probably damaging Het
Csmd2 A C 4: 128,197,225 N186H possibly damaging Het
Cyp1a1 A T 9: 57,700,256 M56L probably benign Het
D2hgdh G C 1: 93,826,407 R56P probably benign Het
Dapk2 A G 9: 66,220,752 E104G probably damaging Het
Dld T C 12: 31,332,214 N498S probably benign Het
Dyrk4 G T 6: 126,898,955 Q106K probably benign Het
Eif2b4 T C 5: 31,189,960 I333V probably damaging Het
F5 A G 1: 164,193,507 T1184A possibly damaging Het
Fbxl6 C T 15: 76,538,412 G102D probably damaging Het
Foxa1 C T 12: 57,542,610 G275R probably benign Het
Fryl A G 5: 73,022,232 I2944T probably damaging Het
Gm597 C A 1: 28,777,414 E512D probably damaging Het
Gna15 T C 10: 81,514,283 D95G probably benign Het
Greb1 T A 12: 16,688,583 M1460L probably benign Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Herc2 T C 7: 56,097,447 I444T probably damaging Het
Ifngr1 T A 10: 19,609,351 M366K probably benign Het
Krt27 C T 11: 99,348,980 E253K probably damaging Het
Micalcl C T 7: 112,381,839 T406I probably damaging Het
Mocs2 T G 13: 114,826,248 D156E probably damaging Het
Mprip A T 11: 59,696,131 K43N probably damaging Het
Myo5b A T 18: 74,617,035 T190S possibly damaging Het
Naa25 C T 5: 121,408,309 T86M probably damaging Het
Ncam1 T C 9: 49,567,339 D163G probably damaging Het
Nlrp4f A T 13: 65,181,654 Y908* probably null Het
Nlrp9b T A 7: 20,023,234 L132* probably null Het
Nrg1 A C 8: 31,818,096 S679A probably damaging Het
Olfr3 C A 2: 36,812,942 R50M possibly damaging Het
Olfr656 C T 7: 104,618,113 R145C probably damaging Het
Paqr9 A T 9: 95,560,997 T347S probably damaging Het
Pcdhb21 T C 18: 37,514,448 L210P probably damaging Het
Pdzd7 T G 19: 45,027,748 D978A probably benign Het
Pkd1l1 A T 11: 8,973,217 S17T unknown Het
Plcz1 T C 6: 140,028,438 K93E possibly damaging Het
Pom121l2 G C 13: 21,981,937 R126P probably damaging Het
Prkg1 C T 19: 31,764,561 E88K probably benign Het
Psme4 A T 11: 30,853,203 D15V probably damaging Het
Ptprf A G 4: 118,231,731 V625A probably benign Het
Rab27a G A 9: 73,085,008 S106N probably damaging Het
Rasa4 A G 5: 136,100,948 T261A probably benign Het
Sardh T C 2: 27,228,257 D487G probably benign Het
Sec16a A G 2: 26,440,018 Y662H probably benign Het
Sema3d T A 5: 12,585,100 L711* probably null Het
Sept14 T A 5: 129,696,117 Y152F probably damaging Het
Smc5 A G 19: 23,242,640 L411P probably damaging Het
Spg7 T A 8: 123,073,911 V39E probably damaging Het
Tas2r117 A G 6: 132,802,854 probably benign Het
Tle1 A T 4: 72,122,450 I631N probably damaging Het
Tmed3 T A 9: 89,699,790 S207C probably damaging Het
Tmem59l G A 8: 70,486,372 P51S probably benign Het
Trpc3 A G 3: 36,624,393 Y848H probably damaging Het
Tsen2 T C 6: 115,549,920 F66S probably damaging Het
Ttll5 T A 12: 85,956,610 S216R probably damaging Het
Usp22 A T 11: 61,157,216 V426E probably damaging Het
Vmn2r76 T C 7: 86,225,906 N621S probably damaging Het
Wdr75 A G 1: 45,817,379 T521A probably damaging Het
Wrnip1 T A 13: 32,802,756 D173E probably damaging Het
Zfp317 G A 9: 19,647,804 G438D probably damaging Het
Zscan10 T A 17: 23,607,190 S109T possibly damaging Het
Other mutations in Crmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Crmp1 APN 5 37276313 missense probably damaging 0.99
IGL02506:Crmp1 APN 5 37278855 splice site probably benign
IGL02904:Crmp1 APN 5 37288918 missense possibly damaging 0.80
IGL02946:Crmp1 APN 5 37284080 missense probably damaging 1.00
IGL02981:Crmp1 APN 5 37286426 missense probably damaging 0.97
IGL03068:Crmp1 APN 5 37265289 missense possibly damaging 0.69
R0049:Crmp1 UTSW 5 37265273 missense possibly damaging 0.52
R0049:Crmp1 UTSW 5 37265273 missense possibly damaging 0.52
R0105:Crmp1 UTSW 5 37284135 missense probably damaging 1.00
R0105:Crmp1 UTSW 5 37284135 missense probably damaging 1.00
R0331:Crmp1 UTSW 5 37265313 missense possibly damaging 0.79
R1226:Crmp1 UTSW 5 37273434 missense probably damaging 1.00
R1372:Crmp1 UTSW 5 37288811 missense probably benign 0.14
R1651:Crmp1 UTSW 5 37273439 missense probably damaging 0.97
R1653:Crmp1 UTSW 5 37286468 missense probably damaging 1.00
R1951:Crmp1 UTSW 5 37273355 missense possibly damaging 0.81
R1977:Crmp1 UTSW 5 37276283 missense probably damaging 1.00
R2107:Crmp1 UTSW 5 37242494 missense probably benign 0.04
R2295:Crmp1 UTSW 5 37265262 missense probably benign
R2495:Crmp1 UTSW 5 37246097 critical splice donor site probably null
R3417:Crmp1 UTSW 5 37268687 missense possibly damaging 0.48
R3788:Crmp1 UTSW 5 37284140 missense probably damaging 1.00
R4490:Crmp1 UTSW 5 37276331 missense probably damaging 0.99
R5338:Crmp1 UTSW 5 37279674 missense probably benign 0.16
R5592:Crmp1 UTSW 5 37265265 missense probably benign 0.09
R5761:Crmp1 UTSW 5 37282868 missense probably benign 0.15
R6243:Crmp1 UTSW 5 37288944 missense probably damaging 1.00
R6726:Crmp1 UTSW 5 37284064 missense probably benign 0.04
R7013:Crmp1 UTSW 5 37268692 synonymous probably null
R7183:Crmp1 UTSW 5 37288817 missense probably benign 0.01
R7360:Crmp1 UTSW 5 37276280 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTCAAGCCATTGCAATGCTC -3'
(R):5'- CTGTACCAGATTCCAGGGTG -3'

Sequencing Primer
(F):5'- GTTTTTCAGAGTGACCGG -3'
(R):5'- GGACCTATGGTGGCCTTCTC -3'
Posted On2018-08-01