Incidental Mutation 'R6750:Spg7'
ID530705
Institutional Source Beutler Lab
Gene Symbol Spg7
Ensembl Gene ENSMUSG00000000738
Gene NameSPG7, paraplegin matrix AAA peptidase subunit
SynonymsCmar, paraplegin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R6750 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location123062942-123097760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123073911 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 39 (V39E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108868] [ENSMUST00000125975] [ENSMUST00000127664] [ENSMUST00000142541] [ENSMUST00000149248] [ENSMUST00000153285]
Predicted Effect probably benign
Transcript: ENSMUST00000108868
SMART Domains Protein: ENSMUSP00000104496
Gene: ENSMUSG00000000738

DomainStartEndE-ValueType
low complexity region 5 60 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
Pfam:FtsH_ext 142 242 5.2e-12 PFAM
transmembrane domain 250 272 N/A INTRINSIC
AAA 341 481 1.96e-19 SMART
Pfam:Peptidase_M41 541 746 1.8e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125975
AA Change: V75E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120361
Gene: ENSMUSG00000000738
AA Change: V75E

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Pfam:FtsH_ext 37 137 8.5e-12 PFAM
transmembrane domain 145 167 N/A INTRINSIC
AAA 236 376 1.96e-19 SMART
Pfam:Peptidase_M41 436 641 9.8e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128803
Predicted Effect probably damaging
Transcript: ENSMUST00000142541
AA Change: V75E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119017
Gene: ENSMUSG00000000738
AA Change: V75E

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Pfam:FtsH_ext 37 137 1.2e-12 PFAM
transmembrane domain 145 167 N/A INTRINSIC
PDB:2QZ4|A 200 230 2e-12 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000149248
AA Change: V180E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119552
Gene: ENSMUSG00000000738
AA Change: V180E

DomainStartEndE-ValueType
low complexity region 5 60 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
Pfam:FtsH_ext 142 242 3.9e-11 PFAM
transmembrane domain 250 272 N/A INTRINSIC
AAA 341 481 1.96e-19 SMART
Pfam:Peptidase_M41 541 746 7e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153285
AA Change: V180E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115039
Gene: ENSMUSG00000000738
AA Change: V180E

DomainStartEndE-ValueType
low complexity region 5 60 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
Pfam:FtsH_ext 142 242 3.8e-11 PFAM
transmembrane domain 250 272 N/A INTRINSIC
AAA 341 481 1.96e-19 SMART
Pfam:Peptidase_M41 515 709 2.5e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153492
AA Change: V39E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133602
Gene: ENSMUSG00000000738
AA Change: V39E

DomainStartEndE-ValueType
Pfam:FtsH_ext 1 102 1.3e-12 PFAM
transmembrane domain 110 132 N/A INTRINSIC
PDB:2QZ4|A 165 192 1e-8 PDB
Meta Mutation Damage Score 0.202 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organelle biogenesis, protein folding, and proteolysis. Mutations in this gene cause autosomal recessive spastic paraplegia 7. Two transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice exhibit impaired motor skills, putativley associated with axonal degeneration in the central and peripheral nervous systems. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,398 S477T possibly damaging Het
5430419D17Rik T A 7: 131,288,245 probably benign Het
Adal A T 2: 121,142,649 L62F probably damaging Het
Akap13 C T 7: 75,739,458 P2375S probably benign Het
Apob T A 12: 7,997,853 L931Q probably damaging Het
Arcn1 A G 9: 44,750,394 V391A possibly damaging Het
Ccdc162 A T 10: 41,561,226 I1729N possibly damaging Het
Cd24a T C 10: 43,582,725 L86P unknown Het
Churc1 C A 12: 76,775,631 H71Q probably damaging Het
Clcn3 A G 8: 60,914,775 L780P possibly damaging Het
Cldn17 C T 16: 88,506,307 G178E possibly damaging Het
Cmah A G 13: 24,464,252 Y345C probably damaging Het
Cntnap5b C T 1: 100,274,499 S357L probably damaging Het
Col6a6 A G 9: 105,783,680 I410T probably damaging Het
Crmp1 T C 5: 37,265,322 probably null Het
Csmd2 A C 4: 128,197,225 N186H possibly damaging Het
Cyp1a1 A T 9: 57,700,256 M56L probably benign Het
D2hgdh G C 1: 93,826,407 R56P probably benign Het
Dapk2 A G 9: 66,220,752 E104G probably damaging Het
Dld T C 12: 31,332,214 N498S probably benign Het
Dyrk4 G T 6: 126,898,955 Q106K probably benign Het
Eif2b4 T C 5: 31,189,960 I333V probably damaging Het
F5 A G 1: 164,193,507 T1184A possibly damaging Het
Fbxl6 C T 15: 76,538,412 G102D probably damaging Het
Foxa1 C T 12: 57,542,610 G275R probably benign Het
Fryl A G 5: 73,022,232 I2944T probably damaging Het
Gm597 C A 1: 28,777,414 E512D probably damaging Het
Gna15 T C 10: 81,514,283 D95G probably benign Het
Greb1 T A 12: 16,688,583 M1460L probably benign Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Herc2 T C 7: 56,097,447 I444T probably damaging Het
Ifngr1 T A 10: 19,609,351 M366K probably benign Het
Krt27 C T 11: 99,348,980 E253K probably damaging Het
Micalcl C T 7: 112,381,839 T406I probably damaging Het
Mocs2 T G 13: 114,826,248 D156E probably damaging Het
Mprip A T 11: 59,696,131 K43N probably damaging Het
Myo5b A T 18: 74,617,035 T190S possibly damaging Het
Naa25 C T 5: 121,408,309 T86M probably damaging Het
Ncam1 T C 9: 49,567,339 D163G probably damaging Het
Nlrp4f A T 13: 65,181,654 Y908* probably null Het
Nlrp9b T A 7: 20,023,234 L132* probably null Het
Nrg1 A C 8: 31,818,096 S679A probably damaging Het
Olfr3 C A 2: 36,812,942 R50M possibly damaging Het
Olfr656 C T 7: 104,618,113 R145C probably damaging Het
Paqr9 A T 9: 95,560,997 T347S probably damaging Het
Pcdhb21 T C 18: 37,514,448 L210P probably damaging Het
Pdzd7 T G 19: 45,027,748 D978A probably benign Het
Pkd1l1 A T 11: 8,973,217 S17T unknown Het
Plcz1 T C 6: 140,028,438 K93E possibly damaging Het
Pom121l2 G C 13: 21,981,937 R126P probably damaging Het
Prkg1 C T 19: 31,764,561 E88K probably benign Het
Psme4 A T 11: 30,853,203 D15V probably damaging Het
Ptprf A G 4: 118,231,731 V625A probably benign Het
Rab27a G A 9: 73,085,008 S106N probably damaging Het
Rasa4 A G 5: 136,100,948 T261A probably benign Het
Sardh T C 2: 27,228,257 D487G probably benign Het
Sec16a A G 2: 26,440,018 Y662H probably benign Het
Sema3d T A 5: 12,585,100 L711* probably null Het
Sept14 T A 5: 129,696,117 Y152F probably damaging Het
Smc5 A G 19: 23,242,640 L411P probably damaging Het
Tas2r117 A G 6: 132,802,854 probably benign Het
Tle1 A T 4: 72,122,450 I631N probably damaging Het
Tmed3 T A 9: 89,699,790 S207C probably damaging Het
Tmem59l G A 8: 70,486,372 P51S probably benign Het
Trpc3 A G 3: 36,624,393 Y848H probably damaging Het
Tsen2 T C 6: 115,549,920 F66S probably damaging Het
Ttll5 T A 12: 85,956,610 S216R probably damaging Het
Usp22 A T 11: 61,157,216 V426E probably damaging Het
Vmn2r76 T C 7: 86,225,906 N621S probably damaging Het
Wdr75 A G 1: 45,817,379 T521A probably damaging Het
Wrnip1 T A 13: 32,802,756 D173E probably damaging Het
Zfp317 G A 9: 19,647,804 G438D probably damaging Het
Zscan10 T A 17: 23,607,190 S109T possibly damaging Het
Other mutations in Spg7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Spg7 APN 8 123076930 missense probably damaging 1.00
IGL01868:Spg7 APN 8 123090236 critical splice donor site probably null
IGL02551:Spg7 APN 8 123076978 missense probably damaging 1.00
IGL02744:Spg7 APN 8 123093661 missense probably damaging 1.00
IGL03161:Spg7 APN 8 123087331 missense probably damaging 1.00
IGL03165:Spg7 APN 8 123080812 critical splice donor site probably null
R0729:Spg7 UTSW 8 123070417 missense probably damaging 0.96
R1580:Spg7 UTSW 8 123090238 unclassified probably benign
R1696:Spg7 UTSW 8 123090225 missense probably benign 0.05
R1909:Spg7 UTSW 8 123080741 missense probably benign 0.01
R3751:Spg7 UTSW 8 123087373 missense probably damaging 1.00
R3753:Spg7 UTSW 8 123087373 missense probably damaging 1.00
R3921:Spg7 UTSW 8 123087373 missense probably damaging 1.00
R3976:Spg7 UTSW 8 123079448 missense probably damaging 1.00
R4908:Spg7 UTSW 8 123080655 missense probably damaging 1.00
R4952:Spg7 UTSW 8 123090171 missense probably damaging 1.00
R5392:Spg7 UTSW 8 123087363 missense probably damaging 1.00
R5637:Spg7 UTSW 8 123094575 missense possibly damaging 0.82
R5684:Spg7 UTSW 8 123073884 missense probably damaging 1.00
R5810:Spg7 UTSW 8 123094569 missense possibly damaging 0.94
R6452:Spg7 UTSW 8 123079423 missense possibly damaging 0.54
R6453:Spg7 UTSW 8 123079423 missense possibly damaging 0.54
R6454:Spg7 UTSW 8 123079423 missense possibly damaging 0.54
R7090:Spg7 UTSW 8 123091752 critical splice donor site probably null
R7213:Spg7 UTSW 8 123090232 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTGCCTGACTCCTGATG -3'
(R):5'- CACGTTGAATGGTCTGATTGAAGAG -3'

Sequencing Primer
(F):5'- GCCTGACTCCTGATGGCCTTC -3'
(R):5'- CCTGGTCTACACAGTGAGTTACAG -3'
Posted On2018-08-01