Incidental Mutation 'R6750:Pkd1l1'
ID530720
Institutional Source Beutler Lab
Gene Symbol Pkd1l1
Ensembl Gene ENSMUSG00000046634
Gene Namepolycystic kidney disease 1 like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6750 (G1)
Quality Score195.009
Status Validated
Chromosome11
Chromosomal Location8826708-8973266 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8973217 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 17 (S17T)
Gene Model predicted gene model for transcript(s):
Predicted Effect unknown
Transcript: ENSMUST00000154153
AA Change: S17T
SMART Domains Protein: ENSMUSP00000120803
Gene: ENSMUSG00000046634
AA Change: S17T

DomainStartEndE-ValueType
low complexity region 172 184 N/A INTRINSIC
PKD 205 287 2.9e0 SMART
PKD 291 369 1.42e-9 SMART
Pfam:REJ 398 1001 1.7e-45 PFAM
low complexity region 1208 1218 N/A INTRINSIC
GPS 1370 1413 1.21e-1 SMART
transmembrane domain 1434 1451 N/A INTRINSIC
LH2 1479 1598 2.94e-3 SMART
transmembrane domain 1640 1659 N/A INTRINSIC
transmembrane domain 1679 1701 N/A INTRINSIC
transmembrane domain 1817 1839 N/A INTRINSIC
transmembrane domain 1854 1876 N/A INTRINSIC
Pfam:PKD_channel 2109 2339 1.5e-23 PFAM
transmembrane domain 2381 2403 N/A INTRINSIC
low complexity region 2436 2449 N/A INTRINSIC
low complexity region 2458 2469 N/A INTRINSIC
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family containing 11 transmembrane domains, a receptor for egg jelly (REJ) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. The encoded protein may play a role in the male reproductive system. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU induced point mutation display lethality throughout fetal growth and development with abnormalities in left right patterning and heterotaxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,398 S477T possibly damaging Het
5430419D17Rik T A 7: 131,288,245 probably benign Het
Adal A T 2: 121,142,649 L62F probably damaging Het
Akap13 C T 7: 75,739,458 P2375S probably benign Het
Apob T A 12: 7,997,853 L931Q probably damaging Het
Arcn1 A G 9: 44,750,394 V391A possibly damaging Het
Ccdc162 A T 10: 41,561,226 I1729N possibly damaging Het
Cd24a T C 10: 43,582,725 L86P unknown Het
Churc1 C A 12: 76,775,631 H71Q probably damaging Het
Clcn3 A G 8: 60,914,775 L780P possibly damaging Het
Cldn17 C T 16: 88,506,307 G178E possibly damaging Het
Cmah A G 13: 24,464,252 Y345C probably damaging Het
Cntnap5b C T 1: 100,274,499 S357L probably damaging Het
Col6a6 A G 9: 105,783,680 I410T probably damaging Het
Crmp1 T C 5: 37,265,322 probably null Het
Csmd2 A C 4: 128,197,225 N186H possibly damaging Het
Cyp1a1 A T 9: 57,700,256 M56L probably benign Het
D2hgdh G C 1: 93,826,407 R56P probably benign Het
Dapk2 A G 9: 66,220,752 E104G probably damaging Het
Dld T C 12: 31,332,214 N498S probably benign Het
Dyrk4 G T 6: 126,898,955 Q106K probably benign Het
Eif2b4 T C 5: 31,189,960 I333V probably damaging Het
F5 A G 1: 164,193,507 T1184A possibly damaging Het
Fbxl6 C T 15: 76,538,412 G102D probably damaging Het
Foxa1 C T 12: 57,542,610 G275R probably benign Het
Fryl A G 5: 73,022,232 I2944T probably damaging Het
Gm597 C A 1: 28,777,414 E512D probably damaging Het
Gna15 T C 10: 81,514,283 D95G probably benign Het
Greb1 T A 12: 16,688,583 M1460L probably benign Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Herc2 T C 7: 56,097,447 I444T probably damaging Het
Ifngr1 T A 10: 19,609,351 M366K probably benign Het
Krt27 C T 11: 99,348,980 E253K probably damaging Het
Micalcl C T 7: 112,381,839 T406I probably damaging Het
Mocs2 T G 13: 114,826,248 D156E probably damaging Het
Mprip A T 11: 59,696,131 K43N probably damaging Het
Myo5b A T 18: 74,617,035 T190S possibly damaging Het
Naa25 C T 5: 121,408,309 T86M probably damaging Het
Ncam1 T C 9: 49,567,339 D163G probably damaging Het
Nlrp4f A T 13: 65,181,654 Y908* probably null Het
Nlrp9b T A 7: 20,023,234 L132* probably null Het
Nrg1 A C 8: 31,818,096 S679A probably damaging Het
Olfr3 C A 2: 36,812,942 R50M possibly damaging Het
Olfr656 C T 7: 104,618,113 R145C probably damaging Het
Paqr9 A T 9: 95,560,997 T347S probably damaging Het
Pcdhb21 T C 18: 37,514,448 L210P probably damaging Het
Pdzd7 T G 19: 45,027,748 D978A probably benign Het
Plcz1 T C 6: 140,028,438 K93E possibly damaging Het
Pom121l2 G C 13: 21,981,937 R126P probably damaging Het
Prkg1 C T 19: 31,764,561 E88K probably benign Het
Psme4 A T 11: 30,853,203 D15V probably damaging Het
Ptprf A G 4: 118,231,731 V625A probably benign Het
Rab27a G A 9: 73,085,008 S106N probably damaging Het
Rasa4 A G 5: 136,100,948 T261A probably benign Het
Sardh T C 2: 27,228,257 D487G probably benign Het
Sec16a A G 2: 26,440,018 Y662H probably benign Het
Sema3d T A 5: 12,585,100 L711* probably null Het
Sept14 T A 5: 129,696,117 Y152F probably damaging Het
Smc5 A G 19: 23,242,640 L411P probably damaging Het
Spg7 T A 8: 123,073,911 V39E probably damaging Het
Tas2r117 A G 6: 132,802,854 probably benign Het
Tle1 A T 4: 72,122,450 I631N probably damaging Het
Tmed3 T A 9: 89,699,790 S207C probably damaging Het
Tmem59l G A 8: 70,486,372 P51S probably benign Het
Trpc3 A G 3: 36,624,393 Y848H probably damaging Het
Tsen2 T C 6: 115,549,920 F66S probably damaging Het
Ttll5 T A 12: 85,956,610 S216R probably damaging Het
Usp22 A T 11: 61,157,216 V426E probably damaging Het
Vmn2r76 T C 7: 86,225,906 N621S probably damaging Het
Wdr75 A G 1: 45,817,379 T521A probably damaging Het
Wrnip1 T A 13: 32,802,756 D173E probably damaging Het
Zfp317 G A 9: 19,647,804 G438D probably damaging Het
Zscan10 T A 17: 23,607,190 S109T possibly damaging Het
Other mutations in Pkd1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Pkd1l1 APN 11 8961971 missense unknown
IGL00156:Pkd1l1 APN 11 8950515 missense probably damaging 1.00
IGL00161:Pkd1l1 APN 11 8929353 critical splice donor site probably null
IGL00489:Pkd1l1 APN 11 8834773 critical splice donor site probably null
IGL00495:Pkd1l1 APN 11 8868493 missense probably benign 0.34
IGL00983:Pkd1l1 APN 11 8844585 missense probably benign
IGL01071:Pkd1l1 APN 11 8848921 missense probably benign 0.00
IGL01093:Pkd1l1 APN 11 8901345 missense probably benign 0.06
IGL01295:Pkd1l1 APN 11 8933685 missense possibly damaging 0.93
IGL01311:Pkd1l1 APN 11 8901174 missense possibly damaging 0.53
IGL01412:Pkd1l1 APN 11 8950409 missense possibly damaging 0.73
IGL01978:Pkd1l1 APN 11 8961336 missense unknown
IGL01999:Pkd1l1 APN 11 8836291 missense probably benign
IGL02080:Pkd1l1 APN 11 8961345 missense unknown
IGL02106:Pkd1l1 APN 11 8833800 missense probably damaging 1.00
IGL02216:Pkd1l1 APN 11 8834897 missense probably damaging 0.96
IGL02305:Pkd1l1 APN 11 8902467 missense probably benign
IGL02337:Pkd1l1 APN 11 8942079 missense probably damaging 1.00
IGL02576:Pkd1l1 APN 11 8844560 missense possibly damaging 0.61
IGL02704:Pkd1l1 APN 11 8834910 missense probably benign 0.00
IGL02814:Pkd1l1 APN 11 8902582 missense probably benign 0.01
IGL02904:Pkd1l1 APN 11 8868450 splice site probably benign
IGL02972:Pkd1l1 APN 11 8863908 missense probably damaging 0.99
IGL03091:Pkd1l1 APN 11 8855564 missense probably damaging 1.00
IGL03113:Pkd1l1 APN 11 8834793 missense probably benign 0.20
IGL03210:Pkd1l1 APN 11 8965127 missense unknown
PIT4581001:Pkd1l1 UTSW 11 8916298 frame shift probably null
R0020:Pkd1l1 UTSW 11 8875765 splice site probably benign
R0020:Pkd1l1 UTSW 11 8875765 splice site probably benign
R0496:Pkd1l1 UTSW 11 8929430 missense probably damaging 0.96
R0547:Pkd1l1 UTSW 11 8836448 splice site probably benign
R0582:Pkd1l1 UTSW 11 8931699 splice site probably benign
R0761:Pkd1l1 UTSW 11 8854375 missense probably damaging 1.00
R0969:Pkd1l1 UTSW 11 8936898 missense probably damaging 1.00
R1348:Pkd1l1 UTSW 11 8834806 missense probably benign 0.18
R1366:Pkd1l1 UTSW 11 8941038 splice site probably benign
R1401:Pkd1l1 UTSW 11 8854487 nonsense probably null
R1444:Pkd1l1 UTSW 11 8854386 missense probably damaging 1.00
R1445:Pkd1l1 UTSW 11 8870313 missense probably benign 0.00
R1463:Pkd1l1 UTSW 11 8916302 missense probably damaging 1.00
R1496:Pkd1l1 UTSW 11 8941077 missense possibly damaging 0.95
R1542:Pkd1l1 UTSW 11 8874179 missense possibly damaging 0.82
R1543:Pkd1l1 UTSW 11 8901200 missense probably damaging 1.00
R1619:Pkd1l1 UTSW 11 8950413 missense probably damaging 0.98
R1875:Pkd1l1 UTSW 11 8844670 splice site probably benign
R1929:Pkd1l1 UTSW 11 8836197 splice site probably benign
R1958:Pkd1l1 UTSW 11 8874161 missense probably benign 0.01
R2223:Pkd1l1 UTSW 11 8889063 missense probably benign 0.18
R2223:Pkd1l1 UTSW 11 8950422 missense probably benign
R2264:Pkd1l1 UTSW 11 8879112 missense probably damaging 0.97
R2349:Pkd1l1 UTSW 11 8826819 splice site probably null
R2431:Pkd1l1 UTSW 11 8947197 missense probably damaging 0.99
R2483:Pkd1l1 UTSW 11 8962701 missense probably damaging 1.00
R2517:Pkd1l1 UTSW 11 8958900 missense unknown
R2888:Pkd1l1 UTSW 11 8947251 missense probably damaging 1.00
R2965:Pkd1l1 UTSW 11 8874236 missense probably damaging 1.00
R3123:Pkd1l1 UTSW 11 8973021 missense unknown
R3153:Pkd1l1 UTSW 11 8867207 missense probably benign 0.01
R3840:Pkd1l1 UTSW 11 8889050 missense probably damaging 1.00
R3855:Pkd1l1 UTSW 11 8965047 critical splice donor site probably null
R3880:Pkd1l1 UTSW 11 8961983 missense unknown
R3970:Pkd1l1 UTSW 11 8874218 missense probably damaging 1.00
R4195:Pkd1l1 UTSW 11 8909929 missense probably damaging 1.00
R4196:Pkd1l1 UTSW 11 8909929 missense probably damaging 1.00
R4246:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4247:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4249:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4250:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4593:Pkd1l1 UTSW 11 8901253 missense probably damaging 0.97
R4609:Pkd1l1 UTSW 11 8958964 missense unknown
R4797:Pkd1l1 UTSW 11 8961340 missense unknown
R4910:Pkd1l1 UTSW 11 8929360 missense possibly damaging 0.50
R4940:Pkd1l1 UTSW 11 8844585 missense probably benign
R5084:Pkd1l1 UTSW 11 8942004 missense probably benign 0.05
R5147:Pkd1l1 UTSW 11 8849003 missense possibly damaging 0.71
R5360:Pkd1l1 UTSW 11 8879204 missense probably benign
R5483:Pkd1l1 UTSW 11 8901141 critical splice donor site probably null
R5604:Pkd1l1 UTSW 11 8833877 missense probably damaging 0.98
R5642:Pkd1l1 UTSW 11 8879202 missense probably damaging 1.00
R5652:Pkd1l1 UTSW 11 8909889 missense probably benign 0.03
R5751:Pkd1l1 UTSW 11 8867204 missense possibly damaging 0.45
R5761:Pkd1l1 UTSW 11 8916301 missense probably damaging 1.00
R5800:Pkd1l1 UTSW 11 8861302 missense probably benign
R5874:Pkd1l1 UTSW 11 8908688 missense probably damaging 1.00
R5897:Pkd1l1 UTSW 11 8879176 missense probably benign 0.03
R5913:Pkd1l1 UTSW 11 8863849 missense probably benign 0.00
R5930:Pkd1l1 UTSW 11 8958969 missense unknown
R6000:Pkd1l1 UTSW 11 8950427 missense probably benign 0.00
R6005:Pkd1l1 UTSW 11 8857113 missense probably damaging 1.00
R6013:Pkd1l1 UTSW 11 8869452 splice site probably null
R6027:Pkd1l1 UTSW 11 8916272 nonsense probably null
R6028:Pkd1l1 UTSW 11 8836267 missense probably benign 0.06
R6129:Pkd1l1 UTSW 11 8868543 missense probably benign 0.00
R6182:Pkd1l1 UTSW 11 8865555 missense probably benign 0.36
R6226:Pkd1l1 UTSW 11 8901287 missense probably benign 0.00
R6257:Pkd1l1 UTSW 11 8942195 missense probably benign 0.22
R6340:Pkd1l1 UTSW 11 8844649 missense probably benign 0.09
R6478:Pkd1l1 UTSW 11 8863911 missense probably benign 0.00
R6558:Pkd1l1 UTSW 11 8889052 missense probably benign 0.00
R6987:Pkd1l1 UTSW 11 8902575 missense probably benign 0.01
R6996:Pkd1l1 UTSW 11 8849046 missense probably damaging 1.00
R7139:Pkd1l1 UTSW 11 8890737 missense
R7224:Pkd1l1 UTSW 11 8945241 missense
R7244:Pkd1l1 UTSW 11 8871771 missense
R7265:Pkd1l1 UTSW 11 8929402 missense
R7358:Pkd1l1 UTSW 11 8945202 missense
R7387:Pkd1l1 UTSW 11 8901203 missense
X0024:Pkd1l1 UTSW 11 8950413 missense probably benign 0.01
X0063:Pkd1l1 UTSW 11 8929430 missense probably damaging 0.96
X0065:Pkd1l1 UTSW 11 8909921 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AAAGAGCTGTTCCGGAAGCC -3'
(R):5'- CCAGTGACTCTTGTACTGCAG -3'

Sequencing Primer
(F):5'- TTCCGGAAGCCACGTGAAC -3'
(R):5'- TGTGAGCACCATAGCCTTAC -3'
Posted On2018-08-01