Incidental Mutation 'R6750:Prkg1'
ID530743
Institutional Source Beutler Lab
Gene Symbol Prkg1
Ensembl Gene ENSMUSG00000052920
Gene Nameprotein kinase, cGMP-dependent, type I
SynonymsPrkgr1b, Prkg1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.521) question?
Stock #R6750 (G1)
Quality Score222.009
Status Validated
Chromosome19
Chromosomal Location30567551-31765033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 31764561 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 88 (E88K)
Ref Sequence ENSEMBL: ENSMUSP00000138208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065067] [ENSMUST00000182685]
Predicted Effect probably benign
Transcript: ENSMUST00000065067
AA Change: E88K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000067576
Gene: ENSMUSG00000052920
AA Change: E88K

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
cNMP 103 216 6.37e-27 SMART
cNMP 221 343 1.23e-33 SMART
S_TKc 360 619 5.25e-91 SMART
S_TK_X 620 671 1.55e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182685
AA Change: E88K

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138208
Gene: ENSMUSG00000052920
AA Change: E88K

DomainStartEndE-ValueType
PDB:1ZXA|B 2 59 4e-9 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammals have three different isoforms of cyclic GMP-dependent protein kinase (Ialpha, Ibeta, and II). These PRKG isoforms act as key mediators of the nitric oxide/cGMP signaling pathway and are important components of many signal transduction processes in diverse cell types. This PRKG1 gene on human chromosome 10 encodes the soluble Ialpha and Ibeta isoforms of PRKG by alternative transcript splicing. A separate gene on human chromosome 4, PRKG2, encodes the membrane-bound PRKG isoform II. The PRKG1 proteins play a central role in regulating cardiovascular and neuronal functions in addition to relaxing smooth muscle tone, preventing platelet aggregation, and modulating cell growth. This gene is most strongly expressed in all types of smooth muscle, platelets, cerebellar Purkinje cells, hippocampal neurons, and the lateral amygdala. Isoforms Ialpha and Ibeta have identical cGMP-binding and catalytic domains but differ in their leucine/isoleucine zipper and autoinhibitory sequences and therefore differ in their dimerization substrates and kinase enzyme activity. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutant mice exhibit abnormal smooth muscle function and penile erectile deficiency. Conditional disruption in the hippocampus results in impaired LTP. Mice homozygous for a transposon induced allele exhibit postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,398 S477T possibly damaging Het
5430419D17Rik T A 7: 131,288,245 probably benign Het
Adal A T 2: 121,142,649 L62F probably damaging Het
Akap13 C T 7: 75,739,458 P2375S probably benign Het
Apob T A 12: 7,997,853 L931Q probably damaging Het
Arcn1 A G 9: 44,750,394 V391A possibly damaging Het
Ccdc162 A T 10: 41,561,226 I1729N possibly damaging Het
Cd24a T C 10: 43,582,725 L86P unknown Het
Churc1 C A 12: 76,775,631 H71Q probably damaging Het
Clcn3 A G 8: 60,914,775 L780P possibly damaging Het
Cldn17 C T 16: 88,506,307 G178E possibly damaging Het
Cmah A G 13: 24,464,252 Y345C probably damaging Het
Cntnap5b C T 1: 100,274,499 S357L probably damaging Het
Col6a6 A G 9: 105,783,680 I410T probably damaging Het
Crmp1 T C 5: 37,265,322 probably null Het
Csmd2 A C 4: 128,197,225 N186H possibly damaging Het
Cyp1a1 A T 9: 57,700,256 M56L probably benign Het
D2hgdh G C 1: 93,826,407 R56P probably benign Het
Dapk2 A G 9: 66,220,752 E104G probably damaging Het
Dld T C 12: 31,332,214 N498S probably benign Het
Dyrk4 G T 6: 126,898,955 Q106K probably benign Het
Eif2b4 T C 5: 31,189,960 I333V probably damaging Het
F5 A G 1: 164,193,507 T1184A possibly damaging Het
Fbxl6 C T 15: 76,538,412 G102D probably damaging Het
Foxa1 C T 12: 57,542,610 G275R probably benign Het
Fryl A G 5: 73,022,232 I2944T probably damaging Het
Gm597 C A 1: 28,777,414 E512D probably damaging Het
Gna15 T C 10: 81,514,283 D95G probably benign Het
Greb1 T A 12: 16,688,583 M1460L probably benign Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Herc2 T C 7: 56,097,447 I444T probably damaging Het
Ifngr1 T A 10: 19,609,351 M366K probably benign Het
Krt27 C T 11: 99,348,980 E253K probably damaging Het
Micalcl C T 7: 112,381,839 T406I probably damaging Het
Mocs2 T G 13: 114,826,248 D156E probably damaging Het
Mprip A T 11: 59,696,131 K43N probably damaging Het
Myo5b A T 18: 74,617,035 T190S possibly damaging Het
Naa25 C T 5: 121,408,309 T86M probably damaging Het
Ncam1 T C 9: 49,567,339 D163G probably damaging Het
Nlrp4f A T 13: 65,181,654 Y908* probably null Het
Nlrp9b T A 7: 20,023,234 L132* probably null Het
Nrg1 A C 8: 31,818,096 S679A probably damaging Het
Olfr3 C A 2: 36,812,942 R50M possibly damaging Het
Olfr656 C T 7: 104,618,113 R145C probably damaging Het
Paqr9 A T 9: 95,560,997 T347S probably damaging Het
Pcdhb21 T C 18: 37,514,448 L210P probably damaging Het
Pdzd7 T G 19: 45,027,748 D978A probably benign Het
Pkd1l1 A T 11: 8,973,217 S17T unknown Het
Plcz1 T C 6: 140,028,438 K93E possibly damaging Het
Pom121l2 G C 13: 21,981,937 R126P probably damaging Het
Psme4 A T 11: 30,853,203 D15V probably damaging Het
Ptprf A G 4: 118,231,731 V625A probably benign Het
Rab27a G A 9: 73,085,008 S106N probably damaging Het
Rasa4 A G 5: 136,100,948 T261A probably benign Het
Sardh T C 2: 27,228,257 D487G probably benign Het
Sec16a A G 2: 26,440,018 Y662H probably benign Het
Sema3d T A 5: 12,585,100 L711* probably null Het
Sept14 T A 5: 129,696,117 Y152F probably damaging Het
Smc5 A G 19: 23,242,640 L411P probably damaging Het
Spg7 T A 8: 123,073,911 V39E probably damaging Het
Tas2r117 A G 6: 132,802,854 probably benign Het
Tle1 A T 4: 72,122,450 I631N probably damaging Het
Tmed3 T A 9: 89,699,790 S207C probably damaging Het
Tmem59l G A 8: 70,486,372 P51S probably benign Het
Trpc3 A G 3: 36,624,393 Y848H probably damaging Het
Tsen2 T C 6: 115,549,920 F66S probably damaging Het
Ttll5 T A 12: 85,956,610 S216R probably damaging Het
Usp22 A T 11: 61,157,216 V426E probably damaging Het
Vmn2r76 T C 7: 86,225,906 N621S probably damaging Het
Wdr75 A G 1: 45,817,379 T521A probably damaging Het
Wrnip1 T A 13: 32,802,756 D173E probably damaging Het
Zfp317 G A 9: 19,647,804 G438D probably damaging Het
Zscan10 T A 17: 23,607,190 S109T possibly damaging Het
Other mutations in Prkg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Prkg1 APN 19 31302340 missense probably benign 0.02
IGL00481:Prkg1 APN 19 30571622 missense probably benign 0.28
IGL00517:Prkg1 APN 19 30894668 missense probably benign
IGL00782:Prkg1 APN 19 30578753 splice site probably benign
IGL01070:Prkg1 APN 19 30569343 splice site probably benign
IGL01106:Prkg1 APN 19 30585278 missense probably benign 0.05
IGL01783:Prkg1 APN 19 30624689 missense probably damaging 1.00
IGL02135:Prkg1 APN 19 30993076 missense probably benign 0.13
IGL02492:Prkg1 APN 19 30724202 missense probably damaging 1.00
IGL02543:Prkg1 APN 19 30624734 missense possibly damaging 0.62
IGL02733:Prkg1 APN 19 31302301 missense probably damaging 1.00
IGL03129:Prkg1 APN 19 30585281 nonsense probably null
IGL03220:Prkg1 APN 19 30569237 utr 3 prime probably benign
R0363:Prkg1 UTSW 19 31664196 missense probably damaging 1.00
R0693:Prkg1 UTSW 19 30594978 missense probably benign
R1099:Prkg1 UTSW 19 30571612 missense probably benign
R1464:Prkg1 UTSW 19 30578870 missense probably damaging 0.99
R1464:Prkg1 UTSW 19 30578870 missense probably damaging 0.99
R1556:Prkg1 UTSW 19 30624743 missense probably benign
R1738:Prkg1 UTSW 19 30786922 missense possibly damaging 0.48
R1974:Prkg1 UTSW 19 31585695 missense probably damaging 1.00
R2011:Prkg1 UTSW 19 31664142 missense possibly damaging 0.94
R2207:Prkg1 UTSW 19 30578860 missense probably damaging 1.00
R2270:Prkg1 UTSW 19 30578631 missense probably benign 0.27
R3009:Prkg1 UTSW 19 31664112 missense possibly damaging 0.74
R4078:Prkg1 UTSW 19 31585578 missense probably damaging 1.00
R4355:Prkg1 UTSW 19 30569229 utr 3 prime probably benign
R4652:Prkg1 UTSW 19 30595012 missense probably damaging 1.00
R4669:Prkg1 UTSW 19 31664239 missense probably damaging 0.98
R4684:Prkg1 UTSW 19 31664179 nonsense probably null
R4789:Prkg1 UTSW 19 31585645 missense probably damaging 0.97
R4826:Prkg1 UTSW 19 31764606 missense possibly damaging 0.93
R4936:Prkg1 UTSW 19 30586375 missense probably benign 0.37
R5625:Prkg1 UTSW 19 31764762 missense possibly damaging 0.95
R5819:Prkg1 UTSW 19 31585672 missense probably benign 0.02
R5855:Prkg1 UTSW 19 30894694 missense possibly damaging 0.93
R5882:Prkg1 UTSW 19 31585697 missense probably damaging 1.00
R5965:Prkg1 UTSW 19 30724156 splice site probably null
R5968:Prkg1 UTSW 19 30592924 missense probably damaging 1.00
R6310:Prkg1 UTSW 19 30569251 missense probably damaging 1.00
R6433:Prkg1 UTSW 19 30781346 missense probably benign 0.21
R6702:Prkg1 UTSW 19 30993084 missense probably benign 0.00
R6894:Prkg1 UTSW 19 30624774 nonsense probably null
R7155:Prkg1 UTSW 19 31302301 missense probably damaging 1.00
R7165:Prkg1 UTSW 19 30585199 missense probably damaging 1.00
R7238:Prkg1 UTSW 19 30624690 missense probably damaging 1.00
X0011:Prkg1 UTSW 19 30993121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACAACTACAGCACGTGATG -3'
(R):5'- TCTCATGCTCAAGGAGGAGAGG -3'

Sequencing Primer
(F):5'- CGTGATGCACAGAAACAAAAATAAAC -3'
(R):5'- CTGGAGAAGCGGCTGTCAG -3'
Posted On2018-08-01