Incidental Mutation 'R6751:Frem2'
ID530754
Institutional Source Beutler Lab
Gene Symbol Frem2
Ensembl Gene ENSMUSG00000037016
Gene NameFras1 related extracellular matrix protein 2
Synonymsmy, ne, 6030440P17Rik, b2b1562Clo, 8430406N05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6751 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location53513938-53657355 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53653665 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 1140 (S1140R)
Ref Sequence ENSEMBL: ENSMUSP00000088670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091137]
Predicted Effect probably damaging
Transcript: ENSMUST00000091137
AA Change: S1140R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088670
Gene: ENSMUSG00000037016
AA Change: S1140R

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Cadherin_3 249 388 4.3e-9 PFAM
Pfam:Cadherin_3 376 532 3e-34 PFAM
Pfam:Cadherin_3 516 665 7.5e-24 PFAM
Pfam:Cadherin_3 632 798 1.6e-21 PFAM
Pfam:Cadherin_3 763 910 1.2e-25 PFAM
Pfam:Cadherin_3 879 1027 5.1e-18 PFAM
Pfam:Cadherin_3 1015 1159 2.2e-20 PFAM
CA 1202 1293 4.8e-1 SMART
Pfam:Cadherin_3 1392 1503 9.8e-24 PFAM
Pfam:Cadherin_3 1504 1612 6.2e-28 PFAM
Pfam:Cadherin_3 1613 1743 5.3e-20 PFAM
Calx_beta 1748 1847 1.5e-5 SMART
Calx_beta 1860 1971 9.47e-12 SMART
Calx_beta 1985 2092 1.65e-11 SMART
Calx_beta 2105 2209 1.99e-5 SMART
Calx_beta 2227 2331 6.9e-14 SMART
transmembrane domain 3103 3125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199323
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The encoded protein localizes to the basement membrane, forming a ternary complex that plays a role in epidermal-dermal interactions. This protein is important for the integrity of skin and renal epithelia. Mutations in this gene are associated with Fraser syndrome. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Kidney development is severely affected and syndactyly is common. Phenotypes of homozygous mutants are indistinguishable from those of Fras1 homozygous mutant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,066,210 N387Y probably damaging Het
4932415D10Rik A G 10: 82,283,497 S4560P probably benign Het
Abhd17a T C 10: 80,586,587 E87G probably damaging Het
Aco1 T A 4: 40,188,330 probably null Het
Adcy6 T C 15: 98,596,205 N817S probably benign Het
Ak8 T A 2: 28,709,945 L63* probably null Het
Arhgef28 G A 13: 98,075,247 S76L probably damaging Het
Asap1 A G 15: 64,094,412 L891S possibly damaging Het
Cacng5 C A 11: 107,877,553 M209I probably benign Het
Casr T C 16: 36,515,588 I120V probably benign Het
Chd7 T C 4: 8,833,866 Y1207H probably damaging Het
Chrnb2 A T 3: 89,761,576 F144Y probably damaging Het
Cyp4a14 T A 4: 115,491,194 H362L probably damaging Het
Dym G A 18: 75,286,647 V630M probably damaging Het
Dyrk1b C A 7: 28,186,709 P619Q probably damaging Het
Dyx1c1 A G 9: 72,961,975 T156A probably benign Het
Eml5 T C 12: 98,865,400 D433G probably damaging Het
Fam58b T C 11: 78,751,124 Y180C probably damaging Het
Gabra5 T C 7: 57,418,334 R255G probably damaging Het
Galnt17 T A 5: 131,081,590 I304F probably damaging Het
Gpc5 A G 14: 115,369,951 S322G probably benign Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Hmcn1 T A 1: 150,734,518 N1467Y probably damaging Het
Ifna6 T C 4: 88,827,750 L112P probably damaging Het
Ifrd1 C T 12: 40,203,914 probably null Het
Il17f A G 1: 20,779,489 M17T probably benign Het
Itga11 G A 9: 62,768,584 V892I probably benign Het
Nckap5l A G 15: 99,423,161 L1246P probably damaging Het
Nlrp4f A T 13: 65,194,429 H467Q probably damaging Het
Ntng2 A G 2: 29,228,043 V131A possibly damaging Het
Olfr550 G A 7: 102,578,499 M1I probably null Het
Olfr889 T G 9: 38,115,975 Y60D probably damaging Het
Olfr970 T A 9: 39,819,897 V86E probably benign Het
Olfr972 T C 9: 39,873,680 V135A probably benign Het
Osbpl8 T C 10: 111,275,013 Y459H possibly damaging Het
Pabpc1 A T 15: 36,597,534 V537D possibly damaging Het
Pde4b A T 4: 102,602,671 M583L probably damaging Het
Phlda1 T C 10: 111,506,694 V97A possibly damaging Het
Pik3cb G T 9: 99,094,521 H174Q probably benign Het
Plxdc2 A T 2: 16,548,141 I117F probably benign Het
Psapl1 C A 5: 36,204,959 C298* probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Rtkn2 T A 10: 68,041,453 F448I probably benign Het
Scn10a T C 9: 119,671,551 R221G probably damaging Het
Serpina3c A G 12: 104,151,500 L193P probably damaging Het
Sox12 T C 2: 152,396,758 Y314C probably damaging Het
Sptbn1 T C 11: 30,117,859 E1772G probably damaging Het
Supt6 A G 11: 78,208,949 V1570A probably benign Het
Synrg T C 11: 83,981,425 F125S probably damaging Het
Tenm4 A T 7: 96,845,712 I1116F possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tfap2d C A 1: 19,103,283 H10N possibly damaging Het
Trpm8 T C 1: 88,384,706 I1103T possibly damaging Het
Vmn1r158 C T 7: 22,789,881 C301Y probably damaging Het
Vmn2r56 T C 7: 12,694,792 I516V probably benign Het
Vmn2r71 G A 7: 85,619,887 probably null Het
Vnn3 C T 10: 23,869,625 R491C probably benign Het
Vps50 A G 6: 3,600,274 Y911C probably damaging Het
Wdr60 A T 12: 116,213,456 V842E possibly damaging Het
Zfp772 C T 7: 7,203,717 R325Q possibly damaging Het
Zranb3 T A 1: 127,959,819 H957L probably benign Het
Zscan20 G T 4: 128,585,875 T941K probably damaging Het
Zscan25 T A 5: 145,290,563 F346I probably damaging Het
Other mutations in Frem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Frem2 APN 3 53585595 missense probably damaging 1.00
IGL00911:Frem2 APN 3 53572462 missense probably damaging 1.00
IGL01322:Frem2 APN 3 53541038 missense probably benign 0.00
IGL01330:Frem2 APN 3 53655241 missense possibly damaging 0.70
IGL01406:Frem2 APN 3 53525896 missense probably damaging 1.00
IGL01556:Frem2 APN 3 53535281 missense probably benign 0.23
IGL01580:Frem2 APN 3 53655175 missense probably damaging 1.00
IGL01606:Frem2 APN 3 53653591 missense possibly damaging 0.69
IGL01611:Frem2 APN 3 53655709 missense probably benign 0.00
IGL01648:Frem2 APN 3 53535732 missense possibly damaging 0.86
IGL01663:Frem2 APN 3 53517013 missense probably damaging 1.00
IGL01665:Frem2 APN 3 53549662 missense probably benign 0.07
IGL01670:Frem2 APN 3 53656937 missense possibly damaging 0.95
IGL01960:Frem2 APN 3 53522304 missense probably benign 0.33
IGL02175:Frem2 APN 3 53655599 missense possibly damaging 0.69
IGL02201:Frem2 APN 3 53519640 missense probably benign 0.35
IGL02202:Frem2 APN 3 53654799 missense probably benign 0.00
IGL02427:Frem2 APN 3 53535763 missense probably damaging 0.97
IGL02457:Frem2 APN 3 53521049 missense probably damaging 0.99
IGL02638:Frem2 APN 3 53551346 missense possibly damaging 0.94
IGL02801:Frem2 APN 3 53652175 missense possibly damaging 0.85
IGL03023:Frem2 APN 3 53655628 missense probably benign 0.40
IGL03169:Frem2 APN 3 53522292 missense probably benign 0.01
IGL03238:Frem2 APN 3 53656261 missense possibly damaging 0.93
IGL03251:Frem2 APN 3 53572308 missense probably benign 0.01
IGL03273:Frem2 APN 3 53537509 nonsense probably null
IGL03343:Frem2 APN 3 53652253 missense probably damaging 1.00
Biosimilar UTSW 3 53654323 missense probably benign 0.01
Fruit_stripe UTSW 3 53537489 missense probably benign 0.21
PIT4366001:Frem2 UTSW 3 53653201 missense probably damaging 0.98
R0019:Frem2 UTSW 3 53523678 missense probably damaging 0.99
R0092:Frem2 UTSW 3 53589796 missense probably benign 0.03
R0108:Frem2 UTSW 3 53647961 missense probably benign 0.03
R0115:Frem2 UTSW 3 53656208 missense probably damaging 0.99
R0118:Frem2 UTSW 3 53535243 nonsense probably null
R0374:Frem2 UTSW 3 53653960 missense probably damaging 1.00
R0437:Frem2 UTSW 3 53653015 missense possibly damaging 0.96
R0531:Frem2 UTSW 3 53519954 missense probably damaging 1.00
R0555:Frem2 UTSW 3 53516860 missense probably damaging 0.97
R0564:Frem2 UTSW 3 53656109 missense probably damaging 0.97
R0586:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R0726:Frem2 UTSW 3 53519626 missense possibly damaging 0.89
R0925:Frem2 UTSW 3 53653973 missense probably benign
R1233:Frem2 UTSW 3 53547778 missense probably damaging 0.98
R1302:Frem2 UTSW 3 53655538 missense probably benign 0.00
R1333:Frem2 UTSW 3 53549731 missense probably benign 0.26
R1446:Frem2 UTSW 3 53654596 missense probably benign 0.31
R1523:Frem2 UTSW 3 53655407 missense possibly damaging 0.73
R1539:Frem2 UTSW 3 53654210 missense probably benign 0.19
R1543:Frem2 UTSW 3 53572455 missense possibly damaging 0.86
R1597:Frem2 UTSW 3 53654519 missense probably benign 0.19
R1600:Frem2 UTSW 3 53547723 missense probably damaging 1.00
R1678:Frem2 UTSW 3 53519938 missense probably damaging 1.00
R1687:Frem2 UTSW 3 53653952 missense probably benign
R1696:Frem2 UTSW 3 53656042 nonsense probably null
R1758:Frem2 UTSW 3 53653357 missense probably damaging 1.00
R1857:Frem2 UTSW 3 53654873 missense probably benign 0.10
R1869:Frem2 UTSW 3 53535196 missense probably benign 0.04
R1921:Frem2 UTSW 3 53653495 missense possibly damaging 0.76
R1973:Frem2 UTSW 3 53652232 missense probably benign 0.01
R2045:Frem2 UTSW 3 53535744 missense probably damaging 1.00
R2113:Frem2 UTSW 3 53652922 missense probably damaging 1.00
R2152:Frem2 UTSW 3 53517029 nonsense probably null
R2164:Frem2 UTSW 3 53537330 missense probably damaging 1.00
R2181:Frem2 UTSW 3 53574587 missense possibly damaging 0.72
R2201:Frem2 UTSW 3 53516573 missense probably benign
R2221:Frem2 UTSW 3 53516857 missense probably benign 0.00
R2255:Frem2 UTSW 3 53652514 missense probably damaging 0.96
R2280:Frem2 UTSW 3 53572423 missense probably damaging 1.00
R3196:Frem2 UTSW 3 53537331 missense probably damaging 1.00
R3716:Frem2 UTSW 3 53572360 missense probably damaging 1.00
R3807:Frem2 UTSW 3 53653449 missense probably benign 0.22
R3820:Frem2 UTSW 3 53516849 missense probably damaging 1.00
R3821:Frem2 UTSW 3 53652415 missense probably damaging 1.00
R3977:Frem2 UTSW 3 53652070 missense probably benign 0.00
R3979:Frem2 UTSW 3 53652070 missense probably benign 0.00
R4014:Frem2 UTSW 3 53652353 missense probably benign 0.01
R4127:Frem2 UTSW 3 53525896 missense probably damaging 1.00
R4195:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4196:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4374:Frem2 UTSW 3 53545502 missense possibly damaging 0.61
R4427:Frem2 UTSW 3 53539162 critical splice donor site probably null
R4428:Frem2 UTSW 3 53654338 missense probably benign 0.40
R4559:Frem2 UTSW 3 53654321 missense probably benign 0.01
R4600:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4602:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4610:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4611:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4661:Frem2 UTSW 3 53655443 missense probably damaging 1.00
R4678:Frem2 UTSW 3 53544371 missense probably benign 0.00
R4689:Frem2 UTSW 3 53547635 missense probably benign 0.43
R4740:Frem2 UTSW 3 53535819 missense probably benign 0.04
R4748:Frem2 UTSW 3 53541093 missense probably damaging 1.00
R4790:Frem2 UTSW 3 53516741 missense probably benign
R4809:Frem2 UTSW 3 53653895 missense probably benign 0.01
R4930:Frem2 UTSW 3 53656315 missense possibly damaging 0.93
R4971:Frem2 UTSW 3 53539183 missense probably damaging 1.00
R5057:Frem2 UTSW 3 53535196 missense probably benign 0.37
R5202:Frem2 UTSW 3 53551346 missense probably benign 0.41
R5221:Frem2 UTSW 3 53585611 missense probably damaging 1.00
R5231:Frem2 UTSW 3 53522295 missense probably damaging 1.00
R5268:Frem2 UTSW 3 53653154 missense probably damaging 0.96
R5480:Frem2 UTSW 3 53656507 nonsense probably null
R5637:Frem2 UTSW 3 53652937 missense probably damaging 0.97
R5664:Frem2 UTSW 3 53652490 missense probably benign 0.33
R5698:Frem2 UTSW 3 53652505 missense possibly damaging 0.89
R5744:Frem2 UTSW 3 53655959 missense probably damaging 1.00
R5754:Frem2 UTSW 3 53537258 missense probably damaging 1.00
R5808:Frem2 UTSW 3 53652563 missense probably damaging 0.96
R5840:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R5874:Frem2 UTSW 3 53537489 missense probably benign 0.21
R6050:Frem2 UTSW 3 53653012 missense probably damaging 0.99
R6103:Frem2 UTSW 3 53549788 missense probably benign 0.00
R6149:Frem2 UTSW 3 53551341 missense probably damaging 0.98
R6182:Frem2 UTSW 3 53647969 missense probably damaging 1.00
R6191:Frem2 UTSW 3 53655280 missense probably benign 0.10
R6245:Frem2 UTSW 3 53655824 missense probably benign 0.00
R6252:Frem2 UTSW 3 53572448 missense probably damaging 1.00
R6393:Frem2 UTSW 3 53585640 missense possibly damaging 0.91
R6416:Frem2 UTSW 3 53572378 missense probably benign 0.01
R6595:Frem2 UTSW 3 53549784 missense probably damaging 1.00
R6665:Frem2 UTSW 3 53654656 missense probably damaging 1.00
R6708:Frem2 UTSW 3 53585501 missense probably benign 0.00
R6787:Frem2 UTSW 3 53654323 missense probably benign 0.01
R6913:Frem2 UTSW 3 53516821 missense probably damaging 1.00
R6916:Frem2 UTSW 3 53547688 missense probably damaging 1.00
R7017:Frem2 UTSW 3 53519602 missense probably benign 0.02
R7083:Frem2 UTSW 3 53537493 missense probably damaging 0.99
R7108:Frem2 UTSW 3 53653513 missense probably damaging 1.00
R7133:Frem2 UTSW 3 53572339 missense possibly damaging 0.82
R7326:Frem2 UTSW 3 53654753 missense probably damaging 1.00
R7341:Frem2 UTSW 3 53654495 missense probably damaging 1.00
R7487:Frem2 UTSW 3 53654549 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CATCAGCAGCGTTGAGGATGAG -3'
(R):5'- TGTGATAAGCCTGACCCACC -3'

Sequencing Primer
(F):5'- ATGAGTCTGTTGACCACCAG -3'
(R):5'- CCTAAGTGCTGAGGACATGGACTC -3'
Posted On2018-08-01