Incidental Mutation 'R6751:Vmn2r71'
ID530772
Institutional Source Beutler Lab
Gene Symbol Vmn2r71
Ensembl Gene ENSMUSG00000091205
Gene Namevomeronasal 2, receptor 71
SynonymsEG233445
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R6751 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location85574614-85624547 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 85619887 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172338]
Predicted Effect probably null
Transcript: ENSMUST00000172338
SMART Domains Protein: ENSMUSP00000132337
Gene: ENSMUSG00000091205

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 468 2.1e-31 PFAM
Pfam:NCD3G 511 563 8.7e-20 PFAM
Pfam:7tm_3 593 831 2e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208545
Meta Mutation Damage Score 0.6252 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 95% (59/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,066,210 N387Y probably damaging Het
4932415D10Rik A G 10: 82,283,497 S4560P probably benign Het
Abhd17a T C 10: 80,586,587 E87G probably damaging Het
Aco1 T A 4: 40,188,330 probably null Het
Adcy6 T C 15: 98,596,205 N817S probably benign Het
Ak8 T A 2: 28,709,945 L63* probably null Het
Arhgef28 G A 13: 98,075,247 S76L probably damaging Het
Asap1 A G 15: 64,094,412 L891S possibly damaging Het
Cacng5 C A 11: 107,877,553 M209I probably benign Het
Casr T C 16: 36,515,588 I120V probably benign Het
Chd7 T C 4: 8,833,866 Y1207H probably damaging Het
Chrnb2 A T 3: 89,761,576 F144Y probably damaging Het
Cyp4a14 T A 4: 115,491,194 H362L probably damaging Het
Dym G A 18: 75,286,647 V630M probably damaging Het
Dyrk1b C A 7: 28,186,709 P619Q probably damaging Het
Dyx1c1 A G 9: 72,961,975 T156A probably benign Het
Eml5 T C 12: 98,865,400 D433G probably damaging Het
Fam58b T C 11: 78,751,124 Y180C probably damaging Het
Frem2 A T 3: 53,653,665 S1140R probably damaging Het
Gabra5 T C 7: 57,418,334 R255G probably damaging Het
Galnt17 T A 5: 131,081,590 I304F probably damaging Het
Gpc5 A G 14: 115,369,951 S322G probably benign Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Hmcn1 T A 1: 150,734,518 N1467Y probably damaging Het
Ifna6 T C 4: 88,827,750 L112P probably damaging Het
Ifrd1 C T 12: 40,203,914 probably null Het
Il17f A G 1: 20,779,489 M17T probably benign Het
Itga11 G A 9: 62,768,584 V892I probably benign Het
Nckap5l A G 15: 99,423,161 L1246P probably damaging Het
Nlrp4f A T 13: 65,194,429 H467Q probably damaging Het
Ntng2 A G 2: 29,228,043 V131A possibly damaging Het
Olfr550 G A 7: 102,578,499 M1I probably null Het
Olfr889 T G 9: 38,115,975 Y60D probably damaging Het
Olfr970 T A 9: 39,819,897 V86E probably benign Het
Olfr972 T C 9: 39,873,680 V135A probably benign Het
Osbpl8 T C 10: 111,275,013 Y459H possibly damaging Het
Pabpc1 A T 15: 36,597,534 V537D possibly damaging Het
Pde4b A T 4: 102,602,671 M583L probably damaging Het
Phlda1 T C 10: 111,506,694 V97A possibly damaging Het
Pik3cb G T 9: 99,094,521 H174Q probably benign Het
Plxdc2 A T 2: 16,548,141 I117F probably benign Het
Psapl1 C A 5: 36,204,959 C298* probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Rtkn2 T A 10: 68,041,453 F448I probably benign Het
Scn10a T C 9: 119,671,551 R221G probably damaging Het
Serpina3c A G 12: 104,151,500 L193P probably damaging Het
Sox12 T C 2: 152,396,758 Y314C probably damaging Het
Sptbn1 T C 11: 30,117,859 E1772G probably damaging Het
Supt6 A G 11: 78,208,949 V1570A probably benign Het
Synrg T C 11: 83,981,425 F125S probably damaging Het
Tenm4 A T 7: 96,845,712 I1116F possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tfap2d C A 1: 19,103,283 H10N possibly damaging Het
Trpm8 T C 1: 88,384,706 I1103T possibly damaging Het
Vmn1r158 C T 7: 22,789,881 C301Y probably damaging Het
Vmn2r56 T C 7: 12,694,792 I516V probably benign Het
Vnn3 C T 10: 23,869,625 R491C probably benign Het
Vps50 A G 6: 3,600,274 Y911C probably damaging Het
Wdr60 A T 12: 116,213,456 V842E possibly damaging Het
Zfp772 C T 7: 7,203,717 R325Q possibly damaging Het
Zranb3 T A 1: 127,959,819 H957L probably benign Het
Zscan20 G T 4: 128,585,875 T941K probably damaging Het
Zscan25 T A 5: 145,290,563 F346I probably damaging Het
Other mutations in Vmn2r71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Vmn2r71 APN 7 85618693 missense probably benign
IGL00960:Vmn2r71 APN 7 85624374 missense probably damaging 1.00
IGL01372:Vmn2r71 APN 7 85620814 splice site probably benign
IGL01690:Vmn2r71 APN 7 85615574 missense probably damaging 1.00
IGL01909:Vmn2r71 APN 7 85620793 missense probably benign 0.00
IGL01950:Vmn2r71 APN 7 85615619 missense probably damaging 0.98
IGL02570:Vmn2r71 APN 7 85615540 missense possibly damaging 0.95
IGL02650:Vmn2r71 APN 7 85624327 missense probably damaging 1.00
IGL02901:Vmn2r71 APN 7 85619262 missense probably benign 0.00
IGL03128:Vmn2r71 APN 7 85619587 missense probably damaging 1.00
IGL03328:Vmn2r71 APN 7 85624291 missense probably damaging 1.00
R0533:Vmn2r71 UTSW 7 85619218 frame shift probably null
R0707:Vmn2r71 UTSW 7 85619432 missense probably benign
R0841:Vmn2r71 UTSW 7 85618541 missense possibly damaging 0.62
R0865:Vmn2r71 UTSW 7 85619308 missense probably benign 0.01
R0883:Vmn2r71 UTSW 7 85623634 missense probably benign 0.19
R0939:Vmn2r71 UTSW 7 85623681 missense possibly damaging 0.70
R1597:Vmn2r71 UTSW 7 85624144 missense possibly damaging 0.46
R1646:Vmn2r71 UTSW 7 85621268 missense probably damaging 0.99
R1719:Vmn2r71 UTSW 7 85621227 missense probably damaging 1.00
R1860:Vmn2r71 UTSW 7 85615574 missense probably damaging 1.00
R2013:Vmn2r71 UTSW 7 85620637 missense probably benign 0.38
R2014:Vmn2r71 UTSW 7 85620637 missense probably benign 0.38
R2015:Vmn2r71 UTSW 7 85620637 missense probably benign 0.38
R2050:Vmn2r71 UTSW 7 85624473 missense probably damaging 1.00
R2084:Vmn2r71 UTSW 7 85618737 missense probably benign 0.03
R2221:Vmn2r71 UTSW 7 85624093 missense probably benign 0.40
R2223:Vmn2r71 UTSW 7 85624093 missense probably benign 0.40
R2245:Vmn2r71 UTSW 7 85624180 missense probably damaging 1.00
R3115:Vmn2r71 UTSW 7 85623658 missense probably damaging 0.97
R3122:Vmn2r71 UTSW 7 85615620 nonsense probably null
R3609:Vmn2r71 UTSW 7 85619662 missense probably damaging 1.00
R4093:Vmn2r71 UTSW 7 85621234 missense probably benign 0.00
R4305:Vmn2r71 UTSW 7 85624152 missense probably damaging 1.00
R4306:Vmn2r71 UTSW 7 85624152 missense probably damaging 1.00
R4334:Vmn2r71 UTSW 7 85619834 missense probably benign 0.01
R4569:Vmn2r71 UTSW 7 85624194 missense possibly damaging 0.66
R4622:Vmn2r71 UTSW 7 85620609 missense probably benign 0.00
R4915:Vmn2r71 UTSW 7 85621268 missense probably damaging 0.99
R4956:Vmn2r71 UTSW 7 85619228 missense probably benign 0.19
R5005:Vmn2r71 UTSW 7 85624144 missense probably damaging 1.00
R5045:Vmn2r71 UTSW 7 85624389 missense probably benign 0.00
R5153:Vmn2r71 UTSW 7 85619222 missense possibly damaging 0.94
R5236:Vmn2r71 UTSW 7 85623669 missense probably damaging 1.00
R5373:Vmn2r71 UTSW 7 85618542 missense possibly damaging 0.79
R5405:Vmn2r71 UTSW 7 85619414 missense probably benign
R5831:Vmn2r71 UTSW 7 85623714 missense probably benign 0.16
R6061:Vmn2r71 UTSW 7 85619274 missense probably benign
R6518:Vmn2r71 UTSW 7 85621228 missense probably damaging 1.00
R6920:Vmn2r71 UTSW 7 85623900 missense probably damaging 1.00
R7358:Vmn2r71 UTSW 7 85624260 missense possibly damaging 0.81
R7453:Vmn2r71 UTSW 7 85624089 missense probably benign 0.21
R7560:Vmn2r71 UTSW 7 85623907 missense probably benign 0.06
X0025:Vmn2r71 UTSW 7 85618665 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCACCATCTAATTGTAAGAAGC -3'
(R):5'- TGCATACCAGTGTTCACTGTGTC -3'

Sequencing Primer
(F):5'- GTCCAACCAAAAGTGTATTTGCATGG -3'
(R):5'- GACAGAAACATAAGCTTCCT -3'
Posted On2018-08-01