Incidental Mutation 'R6752:Vipr1'
ID530838
Institutional Source Beutler Lab
Gene Symbol Vipr1
Ensembl Gene ENSMUSG00000032528
Gene Namevasoactive intestinal peptide receptor 1
SynonymsVPAC1, VIP-R1, VIP receptor subtype 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6752 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location121642716-121672954 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121653893 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 58 (N58S)
Ref Sequence ENSEMBL: ENSMUSP00000035115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035115]
Predicted Effect probably damaging
Transcript: ENSMUST00000035115
AA Change: N58S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035115
Gene: ENSMUSG00000032528
AA Change: N58S

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
HormR 59 131 7.38e-26 SMART
Pfam:7tm_2 140 386 1.4e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213272
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for vasoactive intestinal peptide, a small neuropeptide. Vasoactive intestinal peptide is involved in smooth muscle relaxation, exocrine and endocrine secretion, and water and ion flux in lung and intestinal epithelia. Its actions are effected through integral membrane receptors associated with a guanine nucleotide binding protein which activates adenylate cyclase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal lethality associated with severe neonatal growth failure, enlarged cecum, intestinal hemorrhage, and enterocyte hyperproliferation in addition to disorganized islets and impaired glucose homeostasisin surviving mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,195,483 L45S probably benign Het
Agbl2 G A 2: 90,803,074 C518Y probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Aox1 T C 1: 58,047,239 I101T probably benign Het
Arhgap23 T C 11: 97,452,248 F241S probably damaging Het
Asmt A G X: 170,676,361 M202V probably benign Het
Atp6v0a2 A G 5: 124,641,514 E189G probably damaging Het
Birc3 G A 9: 7,857,344 A376V probably benign Het
Ccbe1 C T 18: 66,076,307 probably null Het
Chst2 C A 9: 95,404,749 E515* probably null Het
Col12a1 A T 9: 79,633,424 N2426K possibly damaging Het
Dmrt2 A G 19: 25,678,342 N435S probably damaging Het
Dnah14 A G 1: 181,593,452 K123E probably benign Het
Dock4 T A 12: 40,820,617 L1452Q probably damaging Het
Galnt7 G A 8: 57,652,951 R10C probably damaging Het
Gm16506 A G 14: 43,727,419 I22T unknown Het
H2-Q6 A G 17: 35,428,127 T292A probably damaging Het
Ifne A G 4: 88,880,082 M33T probably benign Het
Igf2r G A 17: 12,714,944 R808W probably damaging Het
Igfbp5 T C 1: 72,863,909 E169G probably damaging Het
Inppl1 G A 7: 101,832,542 R198* probably null Het
Irgm1 T C 11: 48,866,463 T174A probably damaging Het
Itih3 C T 14: 30,923,489 G21S possibly damaging Het
Klra4 G T 6: 130,062,028 Q134K probably benign Het
Mfsd1 T A 3: 67,596,603 Y309* probably null Het
Mrps10 A G 17: 47,377,815 N162S probably damaging Het
Mtmr14 T C 6: 113,240,397 F90S probably damaging Het
Myh15 A G 16: 49,182,927 D1783G probably damaging Het
Myo3b A G 2: 70,289,512 E972G probably damaging Het
Myt1 G T 2: 181,801,082 V455F probably damaging Het
Nbea T A 3: 55,968,309 T1647S probably benign Het
Nbea A T 3: 56,037,219 S575T probably benign Het
Ntn4 A G 10: 93,734,175 N466S probably benign Het
Olfr1113 A G 2: 87,213,044 M51V probably benign Het
Olfr1468-ps1 T A 19: 13,375,526 L188H unknown Het
Olfr197 T A 16: 59,186,331 N51Y probably damaging Het
Pcdhgb4 T A 18: 37,720,651 I33N probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pom121l2 T G 13: 21,981,769 F70C probably damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Rab11fip2 T C 19: 59,907,043 D471G probably damaging Het
Rnh1 A G 7: 141,163,441 V207A probably benign Het
Sh3tc2 C A 18: 61,961,037 T49N probably benign Het
Skint4 T C 4: 112,119,863 M158T possibly damaging Het
Skint7 T A 4: 111,980,266 H80Q probably benign Het
Smg1 A G 7: 118,163,316 probably benign Het
Sostdc1 T C 12: 36,314,412 V40A probably benign Het
Sptlc1 C A 13: 53,335,358 K437N possibly damaging Het
Stat2 T C 10: 128,283,753 F503L probably damaging Het
Syt16 A T 12: 74,229,213 probably null Het
Tspyl1 T C 10: 34,282,587 S103P probably benign Het
Ube4a A T 9: 44,925,948 S1053R probably damaging Het
Zfp184 C A 13: 21,959,408 A428E probably damaging Het
Zfp292 A C 4: 34,808,593 F1484V possibly damaging Het
Zfp599 G A 9: 22,249,544 H442Y probably damaging Het
Zfp944 G A 17: 22,339,519 T249I probably benign Het
Zkscan14 T A 5: 145,195,506 H405L probably damaging Het
Other mutations in Vipr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Vipr1 APN 9 121665178 missense probably damaging 0.99
IGL01779:Vipr1 APN 9 121664630 missense probably damaging 1.00
IGL01809:Vipr1 APN 9 121661440 missense possibly damaging 0.70
IGL02250:Vipr1 APN 9 121665189 missense probably benign 0.10
IGL02677:Vipr1 APN 9 121660283 splice site probably benign
bernalillo UTSW 9 121664618 missense probably damaging 1.00
R0036:Vipr1 UTSW 9 121660983 missense probably benign
R0514:Vipr1 UTSW 9 121658049 missense probably damaging 1.00
R0629:Vipr1 UTSW 9 121660171 nonsense probably null
R1470:Vipr1 UTSW 9 121665520 missense possibly damaging 0.66
R1470:Vipr1 UTSW 9 121665520 missense possibly damaging 0.66
R1766:Vipr1 UTSW 9 121661419 missense possibly damaging 0.87
R1884:Vipr1 UTSW 9 121665864 missense possibly damaging 0.56
R1945:Vipr1 UTSW 9 121668474 missense probably damaging 1.00
R1945:Vipr1 UTSW 9 121668475 missense probably damaging 1.00
R2366:Vipr1 UTSW 9 121665184 missense probably benign 0.19
R4275:Vipr1 UTSW 9 121664618 missense probably damaging 1.00
R4600:Vipr1 UTSW 9 121665136 splice site probably null
R5012:Vipr1 UTSW 9 121658045 critical splice acceptor site probably null
R6190:Vipr1 UTSW 9 121664653 missense probably damaging 1.00
R6376:Vipr1 UTSW 9 121664574 missense probably damaging 1.00
R6473:Vipr1 UTSW 9 121668555 missense probably damaging 1.00
R6476:Vipr1 UTSW 9 121669423 missense probably benign 0.28
R6641:Vipr1 UTSW 9 121669565 makesense probably null
R7189:Vipr1 UTSW 9 121664554 missense probably damaging 0.97
R7371:Vipr1 UTSW 9 121668555 missense probably damaging 1.00
R7419:Vipr1 UTSW 9 121661473 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGATCAACTTTGACTGACCTAGC -3'
(R):5'- CAGATAAGAGCTGGGAACTCC -3'

Sequencing Primer
(F):5'- AACTTTGACTGACCTAGCTTGGC -3'
(R):5'- CAGATGTGGATGGGGTCAG -3'
Posted On2018-08-01