Incidental Mutation 'R6753:Olfr987'
ID530873
Institutional Source Beutler Lab
Gene Symbol Olfr987
Ensembl Gene ENSMUSG00000075223
Gene Nameolfactory receptor 987
SynonymsMOR203-7P, GA_x6K02T2Q125-46808500-46807571
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6753 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location85330779-85339315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 85331798 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 33 (M33I)
Ref Sequence ENSEMBL: ENSMUSP00000150619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099929] [ENSMUST00000111598] [ENSMUST00000216347]
Predicted Effect probably benign
Transcript: ENSMUST00000099929
AA Change: M33I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097513
Gene: ENSMUSG00000075223
AA Change: M33I

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.4e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 254 5.9e-6 PFAM
Pfam:7tm_1 41 290 1.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111598
AA Change: M33I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107225
Gene: ENSMUSG00000075223
AA Change: M33I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 254 5.9e-6 PFAM
Pfam:7tm_1 41 290 1.7e-31 PFAM
Pfam:7tm_4 139 283 6.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216347
AA Change: M33I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 120,010,151 P1083S probably benign Het
Abcb5 T A 12: 118,944,906 N101I possibly damaging Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Agk T A 6: 40,368,570 probably null Het
Akap10 A T 11: 61,886,777 M586K probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Armc1 A G 3: 19,144,398 F133L possibly damaging Het
Bank1 T C 3: 136,093,308 E424G probably damaging Het
Cacna1a A G 8: 84,580,205 E1363G probably damaging Het
Cacna1d C A 14: 30,042,786 A2076S probably damaging Het
Ccdc73 T A 2: 104,991,524 L606* probably null Het
Ccdc8 C T 7: 16,996,637 Q684* probably null Het
Ces1b T A 8: 93,067,020 K314* probably null Het
Ces1e T A 8: 93,215,128 N238I probably damaging Het
Chd4 A G 6: 125,114,300 N1238S probably benign Het
Cmtr2 T A 8: 110,222,979 D640E probably damaging Het
Col7a1 C T 9: 108,958,128 T559I unknown Het
Comt T C 16: 18,408,021 K205R probably benign Het
Dbp A T 7: 45,708,404 E232V probably damaging Het
Dcbld2 A G 16: 58,456,130 T470A possibly damaging Het
Eml6 T A 11: 29,754,987 D1519V probably damaging Het
Evpl T A 11: 116,237,906 H31L possibly damaging Het
Exoc1 T A 5: 76,563,339 I86N probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fgfr3 T C 5: 33,732,159 S301P probably benign Het
Gas2l1 C T 11: 5,064,254 V69I probably damaging Het
Gm2042 T A 12: 87,958,084 I107K probably damaging Het
Gucy1b1 T C 3: 82,039,747 D385G probably null Het
Ints1 T A 5: 139,765,175 E824D probably damaging Het
Itfg1 T C 8: 85,835,078 D142G probably benign Het
Jaml A G 9: 45,107,379 N359D probably benign Het
Kcnh7 T A 2: 62,850,377 I289L probably benign Het
Klf12 G A 14: 100,109,776 Q40* probably null Het
Mcm4 A C 16: 15,629,362 N579K possibly damaging Het
Mfsd2b A T 12: 4,867,358 F179I possibly damaging Het
Mmp11 C T 10: 75,928,374 V86M probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Otog A C 7: 46,249,071 E204D probably benign Het
Parp8 G A 13: 116,895,115 H354Y possibly damaging Het
Pcnx C A 12: 81,964,480 D1238E probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pkd1l3 C T 8: 109,624,449 T642I probably damaging Het
Pkhd1l1 G A 15: 44,589,663 E3995K probably benign Het
Prdm9 A T 17: 15,544,956 Y521N probably benign Het
Prex2 A G 1: 11,184,456 S1105G probably damaging Het
Prss35 T A 9: 86,756,100 F308I probably damaging Het
Rab22a C T 2: 173,701,055 A167V probably benign Het
Rims2 A G 15: 39,566,973 Q871R possibly damaging Het
Rorb A T 19: 18,957,247 M253K probably benign Het
Ryr3 T C 2: 112,652,610 D4269G probably damaging Het
Snx11 T C 11: 96,769,906 probably benign Het
Son A G 16: 91,657,188 Q941R probably damaging Het
Sptbn2 G T 19: 4,747,785 R1880L probably benign Het
Sun1 G A 5: 139,215,259 probably null Het
Tprn A G 2: 25,264,038 R451G probably benign Het
Trbv30 T A 6: 41,281,377 M1K probably null Het
Ttn C A 2: 76,738,221 G25697W probably damaging Het
Ubb T G 11: 62,551,527 probably null Het
Unc13b C T 4: 43,239,331 R1038C probably damaging Het
Usp7 T C 16: 8,696,911 M687V probably benign Het
Zfp160 G A 17: 21,020,734 M21I probably benign Het
Zfp868 T C 8: 69,612,096 N196S probably benign Het
Zufsp A T 10: 33,928,029 I483N probably damaging Het
Other mutations in Olfr987
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01766:Olfr987 APN 2 85331601 missense probably benign 0.37
IGL02267:Olfr987 APN 2 85331121 missense probably damaging 1.00
IGL03167:Olfr987 APN 2 85331320 missense probably benign 0.01
IGL03195:Olfr987 APN 2 85331520 missense probably damaging 1.00
R0918:Olfr987 UTSW 2 85331932 intron probably benign
R1573:Olfr987 UTSW 2 85331343 missense probably damaging 1.00
R1956:Olfr987 UTSW 2 85331100 missense probably benign 0.00
R2165:Olfr987 UTSW 2 85331102 missense probably benign
R4086:Olfr987 UTSW 2 85331826 missense probably benign 0.35
R5386:Olfr987 UTSW 2 85331635 missense probably benign 0.00
R5652:Olfr987 UTSW 2 85331373 missense probably damaging 1.00
R6755:Olfr987 UTSW 2 85331798 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTTGCAAAAGTACCATAGGC -3'
(R):5'- TCAGGGATAATGTCTTCAGCC -3'

Sequencing Primer
(F):5'- GGCTAGTAGCTGTAACATACATCC -3'
(R):5'- TGACACCAAAGTGACTGA -3'
Posted On2018-08-01