Incidental Mutation 'R6753:Unc13b'
ID530880
Institutional Source Beutler Lab
Gene Symbol Unc13b
Ensembl Gene ENSMUSG00000028456
Gene Nameunc-13 homolog B (C. elegans)
SynonymsUnc13h2, Munc13-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.511) question?
Stock #R6753 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location43058953-43264871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43239331 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 1038 (R1038C)
Ref Sequence ENSEMBL: ENSMUSP00000146589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079978] [ENSMUST00000107952] [ENSMUST00000107953] [ENSMUST00000163653] [ENSMUST00000207569] [ENSMUST00000207708]
Predicted Effect probably damaging
Transcript: ENSMUST00000079978
AA Change: R665C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078894
Gene: ENSMUSG00000028456
AA Change: R665C

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1262 1404 4.8e-60 PFAM
C2 1438 1544 7.56e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107952
AA Change: R677C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103586
Gene: ENSMUSG00000028456
AA Change: R677C

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1033 2.02e-53 SMART
Pfam:Membr_traf_MHD 1274 1416 4.8e-60 PFAM
C2 1450 1556 7.56e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107953
AA Change: R665C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103587
Gene: ENSMUSG00000028456
AA Change: R665C

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1263 1403 2.3e-56 PFAM
C2 1457 1563 7.56e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149945
Predicted Effect probably damaging
Transcript: ENSMUST00000163653
AA Change: R677C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128608
Gene: ENSMUSG00000028456
AA Change: R677C

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1032 4.64e-53 SMART
Pfam:Membr_traf_MHD 1273 1415 4.8e-60 PFAM
C2 1449 1555 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168032
SMART Domains Protein: ENSMUSP00000132622
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C1 147 196 4.21e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207569
AA Change: R3465C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000207708
AA Change: R1038C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed in the kidney cortical epithelial cells and is upregulated by hyperglycemia. The encoded protein shares a high level of similarity to the rat homolog, and contains 3 C2 domains and a diacylglycerol-binding C1 domain. Hyperglycemia increases the levels of diacylglycerol, which has been shown to induce apoptosis in cells transfected with this gene and thus contribute to the renal cell complications of hyperglycemia. Studies in other species also indicate a role for this protein in the priming step of synaptic vesicle exocytosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are grossly phenotypically normal. Mice older than 12 months will exhibit sporadic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 120,010,151 P1083S probably benign Het
Abcb5 T A 12: 118,944,906 N101I possibly damaging Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Agk T A 6: 40,368,570 probably null Het
Akap10 A T 11: 61,886,777 M586K probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Armc1 A G 3: 19,144,398 F133L possibly damaging Het
Bank1 T C 3: 136,093,308 E424G probably damaging Het
Cacna1a A G 8: 84,580,205 E1363G probably damaging Het
Cacna1d C A 14: 30,042,786 A2076S probably damaging Het
Ccdc73 T A 2: 104,991,524 L606* probably null Het
Ccdc8 C T 7: 16,996,637 Q684* probably null Het
Ces1b T A 8: 93,067,020 K314* probably null Het
Ces1e T A 8: 93,215,128 N238I probably damaging Het
Chd4 A G 6: 125,114,300 N1238S probably benign Het
Cmtr2 T A 8: 110,222,979 D640E probably damaging Het
Col7a1 C T 9: 108,958,128 T559I unknown Het
Comt T C 16: 18,408,021 K205R probably benign Het
Dbp A T 7: 45,708,404 E232V probably damaging Het
Dcbld2 A G 16: 58,456,130 T470A possibly damaging Het
Eml6 T A 11: 29,754,987 D1519V probably damaging Het
Evpl T A 11: 116,237,906 H31L possibly damaging Het
Exoc1 T A 5: 76,563,339 I86N probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fgfr3 T C 5: 33,732,159 S301P probably benign Het
Gas2l1 C T 11: 5,064,254 V69I probably damaging Het
Gm2042 T A 12: 87,958,084 I107K probably damaging Het
Gucy1b1 T C 3: 82,039,747 D385G probably null Het
Ints1 T A 5: 139,765,175 E824D probably damaging Het
Itfg1 T C 8: 85,835,078 D142G probably benign Het
Jaml A G 9: 45,107,379 N359D probably benign Het
Kcnh7 T A 2: 62,850,377 I289L probably benign Het
Klf12 G A 14: 100,109,776 Q40* probably null Het
Mcm4 A C 16: 15,629,362 N579K possibly damaging Het
Mfsd2b A T 12: 4,867,358 F179I possibly damaging Het
Mmp11 C T 10: 75,928,374 V86M probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otog A C 7: 46,249,071 E204D probably benign Het
Parp8 G A 13: 116,895,115 H354Y possibly damaging Het
Pcnx C A 12: 81,964,480 D1238E probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pkd1l3 C T 8: 109,624,449 T642I probably damaging Het
Pkhd1l1 G A 15: 44,589,663 E3995K probably benign Het
Prdm9 A T 17: 15,544,956 Y521N probably benign Het
Prex2 A G 1: 11,184,456 S1105G probably damaging Het
Prss35 T A 9: 86,756,100 F308I probably damaging Het
Rab22a C T 2: 173,701,055 A167V probably benign Het
Rims2 A G 15: 39,566,973 Q871R possibly damaging Het
Rorb A T 19: 18,957,247 M253K probably benign Het
Ryr3 T C 2: 112,652,610 D4269G probably damaging Het
Snx11 T C 11: 96,769,906 probably benign Het
Son A G 16: 91,657,188 Q941R probably damaging Het
Sptbn2 G T 19: 4,747,785 R1880L probably benign Het
Sun1 G A 5: 139,215,259 probably null Het
Tprn A G 2: 25,264,038 R451G probably benign Het
Trbv30 T A 6: 41,281,377 M1K probably null Het
Ttn C A 2: 76,738,221 G25697W probably damaging Het
Ubb T G 11: 62,551,527 probably null Het
Usp7 T C 16: 8,696,911 M687V probably benign Het
Zfp160 G A 17: 21,020,734 M21I probably benign Het
Zfp868 T C 8: 69,612,096 N196S probably benign Het
Zufsp A T 10: 33,928,029 I483N probably damaging Het
Other mutations in Unc13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Unc13b APN 4 43240285 missense probably damaging 1.00
IGL00832:Unc13b APN 4 43258921 missense probably damaging 1.00
IGL01111:Unc13b APN 4 43096927 missense possibly damaging 0.76
IGL01115:Unc13b APN 4 43258492 missense probably damaging 1.00
IGL01137:Unc13b APN 4 43091291 missense probably damaging 1.00
IGL01637:Unc13b APN 4 43241066 missense probably damaging 1.00
IGL01789:Unc13b APN 4 43239462 missense probably damaging 1.00
IGL01792:Unc13b APN 4 43250218 missense probably damaging 0.99
IGL01877:Unc13b APN 4 43249583 critical splice donor site probably null
IGL01924:Unc13b APN 4 43239385 nonsense probably null
IGL02087:Unc13b APN 4 43091270 missense probably null 1.00
IGL02197:Unc13b APN 4 43165828 missense probably damaging 0.99
IGL02504:Unc13b APN 4 43263031 missense probably damaging 1.00
IGL02659:Unc13b APN 4 43235332 missense probably damaging 1.00
IGL03031:Unc13b APN 4 43235368 missense probably damaging 1.00
IGL03036:Unc13b APN 4 43235249 missense probably damaging 1.00
IGL03209:Unc13b APN 4 43239351 missense probably damaging 0.99
IGL03352:Unc13b APN 4 43237110 missense possibly damaging 0.90
P0028:Unc13b UTSW 4 43256225 missense probably damaging 1.00
PIT4585001:Unc13b UTSW 4 43091298 missense probably benign 0.03
R0019:Unc13b UTSW 4 43096990 missense possibly damaging 0.58
R0019:Unc13b UTSW 4 43096990 missense possibly damaging 0.58
R0335:Unc13b UTSW 4 43236983 missense possibly damaging 0.95
R0504:Unc13b UTSW 4 43263559 missense probably damaging 0.99
R0631:Unc13b UTSW 4 43182849 missense possibly damaging 0.47
R0748:Unc13b UTSW 4 43241164 splice site probably benign
R1275:Unc13b UTSW 4 43235366 missense probably damaging 1.00
R1293:Unc13b UTSW 4 43235190 missense probably damaging 1.00
R1434:Unc13b UTSW 4 43239385 nonsense probably null
R1552:Unc13b UTSW 4 43237144 missense probably damaging 0.99
R1591:Unc13b UTSW 4 43244747 missense probably damaging 1.00
R1628:Unc13b UTSW 4 43263371 missense probably damaging 1.00
R1740:Unc13b UTSW 4 43240285 missense probably damaging 1.00
R1839:Unc13b UTSW 4 43258308 splice site probably benign
R2045:Unc13b UTSW 4 43091266 missense probably damaging 1.00
R2191:Unc13b UTSW 4 43245566 nonsense probably null
R2259:Unc13b UTSW 4 43182780 missense possibly damaging 0.87
R2307:Unc13b UTSW 4 43239854 missense probably damaging 0.98
R2317:Unc13b UTSW 4 43245514 missense probably damaging 1.00
R2402:Unc13b UTSW 4 43095843 missense probably benign
R2847:Unc13b UTSW 4 43180404 missense probably benign 0.04
R3414:Unc13b UTSW 4 43234658 splice site probably benign
R3436:Unc13b UTSW 4 43097028 splice site probably benign
R3955:Unc13b UTSW 4 43256834 missense probably damaging 1.00
R3957:Unc13b UTSW 4 43256834 missense probably damaging 1.00
R4015:Unc13b UTSW 4 43237801 missense probably damaging 1.00
R4650:Unc13b UTSW 4 43261035 missense probably damaging 0.97
R4836:Unc13b UTSW 4 43237137 missense probably damaging 1.00
R5041:Unc13b UTSW 4 43237836 missense probably benign 0.41
R5413:Unc13b UTSW 4 43257936 critical splice donor site probably null
R5994:Unc13b UTSW 4 43172596 intron probably benign
R6015:Unc13b UTSW 4 43177995 nonsense probably null
R6090:Unc13b UTSW 4 43239306 missense probably damaging 1.00
R6242:Unc13b UTSW 4 43165800 missense possibly damaging 0.92
R6246:Unc13b UTSW 4 43216246 missense probably benign 0.18
R6427:Unc13b UTSW 4 43176966 unclassified probably benign
R6660:Unc13b UTSW 4 43177412 unclassified probably benign
R6670:Unc13b UTSW 4 43255562 missense probably damaging 0.99
R6858:Unc13b UTSW 4 43165828 missense possibly damaging 0.85
R6886:Unc13b UTSW 4 43170156 intron probably benign
R6969:Unc13b UTSW 4 43263538 missense possibly damaging 0.94
R6994:Unc13b UTSW 4 43171403 intron probably benign
R6994:Unc13b UTSW 4 43173203 intron probably benign
R7080:Unc13b UTSW 4 43171926 missense unknown
R7117:Unc13b UTSW 4 43216544 missense probably benign 0.33
R7132:Unc13b UTSW 4 43215757 missense probably benign 0.17
R7181:Unc13b UTSW 4 43258893 missense probably damaging 0.99
R7192:Unc13b UTSW 4 43258519 missense probably damaging 1.00
R7246:Unc13b UTSW 4 43172910 missense unknown
R7342:Unc13b UTSW 4 43258703 missense probably damaging 0.99
R7345:Unc13b UTSW 4 43173966 missense unknown
R7355:Unc13b UTSW 4 43237754 missense probably damaging 1.00
R7391:Unc13b UTSW 4 43216459 missense probably benign 0.03
R7419:Unc13b UTSW 4 43174023 missense unknown
R7424:Unc13b UTSW 4 43172235 missense unknown
Predicted Primers PCR Primer
(F):5'- CTGCATGAGAAGCCAGAATGTAC -3'
(R):5'- TCCGGATGGTCTCCAATCACAG -3'

Sequencing Primer
(F):5'- TGAGAAGCCAGAATGTACCATAAC -3'
(R):5'- GGATGGTCTCCAATCACAGTAACAC -3'
Posted On2018-08-01