Incidental Mutation 'R6753:Otog'
ID530892
Institutional Source Beutler Lab
Gene Symbol Otog
Ensembl Gene ENSMUSG00000009487
Gene Nameotogelin
SynonymsOtgn
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.657) question?
Stock #R6753 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location46240987-46311434 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 46249071 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 204 (E204D)
Ref Sequence ENSEMBL: ENSMUSP00000130949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164538]
Predicted Effect probably benign
Transcript: ENSMUST00000164538
AA Change: E204D

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000130949
Gene: ENSMUSG00000009487
AA Change: E204D

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
VWD 128 288 7.98e-45 SMART
C8 330 404 1.05e-13 SMART
VWC 463 505 1.24e0 SMART
VWD 490 655 4.94e-50 SMART
C8 693 758 1.23e-5 SMART
Pfam:TIL 767 831 3.4e-13 PFAM
VWC 935 983 1.83e0 SMART
VWD 962 1118 6.05e-45 SMART
C8 1153 1227 1.02e-34 SMART
Pfam:AbfB 1270 1384 7.5e-10 PFAM
low complexity region 1488 1513 N/A INTRINSIC
low complexity region 1524 1536 N/A INTRINSIC
low complexity region 1560 1578 N/A INTRINSIC
low complexity region 1637 1644 N/A INTRINSIC
low complexity region 1677 1696 N/A INTRINSIC
low complexity region 1731 1748 N/A INTRINSIC
VWD 2087 2251 2.37e-29 SMART
C8 2287 2356 4.93e-19 SMART
low complexity region 2443 2449 N/A INTRINSIC
CT 2828 2911 3.46e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210281
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the acellular membranes of the inner ear. Disruption of the orthologous mouse gene shows that it plays a role in auditory and vestibular functions. It is involved in fibrillar network organization, the anchoring of otoconial membranes and cupulae to the neuroepithelia, and likely in sound stimulation resistance. Mutations in this gene cause autosomal recessive nonsyndromic deafness, type 18B. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for a number of different spontaneous and targeted mutations exhibit vestibular dysfunction, including circling, head tilt, impaired balance, coordination, and placing response. Mutants have impaired hearing, decreased brain stem auditory evoked potential, and ear abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 120,010,151 P1083S probably benign Het
Abcb5 T A 12: 118,944,906 N101I possibly damaging Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Agk T A 6: 40,368,570 probably null Het
Akap10 A T 11: 61,886,777 M586K probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Armc1 A G 3: 19,144,398 F133L possibly damaging Het
Bank1 T C 3: 136,093,308 E424G probably damaging Het
Cacna1a A G 8: 84,580,205 E1363G probably damaging Het
Cacna1d C A 14: 30,042,786 A2076S probably damaging Het
Ccdc73 T A 2: 104,991,524 L606* probably null Het
Ccdc8 C T 7: 16,996,637 Q684* probably null Het
Ces1b T A 8: 93,067,020 K314* probably null Het
Ces1e T A 8: 93,215,128 N238I probably damaging Het
Chd4 A G 6: 125,114,300 N1238S probably benign Het
Cmtr2 T A 8: 110,222,979 D640E probably damaging Het
Col7a1 C T 9: 108,958,128 T559I unknown Het
Comt T C 16: 18,408,021 K205R probably benign Het
Dbp A T 7: 45,708,404 E232V probably damaging Het
Dcbld2 A G 16: 58,456,130 T470A possibly damaging Het
Eml6 T A 11: 29,754,987 D1519V probably damaging Het
Evpl T A 11: 116,237,906 H31L possibly damaging Het
Exoc1 T A 5: 76,563,339 I86N probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fgfr3 T C 5: 33,732,159 S301P probably benign Het
Gas2l1 C T 11: 5,064,254 V69I probably damaging Het
Gm2042 T A 12: 87,958,084 I107K probably damaging Het
Gucy1b1 T C 3: 82,039,747 D385G probably null Het
Ints1 T A 5: 139,765,175 E824D probably damaging Het
Itfg1 T C 8: 85,835,078 D142G probably benign Het
Jaml A G 9: 45,107,379 N359D probably benign Het
Kcnh7 T A 2: 62,850,377 I289L probably benign Het
Klf12 G A 14: 100,109,776 Q40* probably null Het
Mcm4 A C 16: 15,629,362 N579K possibly damaging Het
Mfsd2b A T 12: 4,867,358 F179I possibly damaging Het
Mmp11 C T 10: 75,928,374 V86M probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Parp8 G A 13: 116,895,115 H354Y possibly damaging Het
Pcnx C A 12: 81,964,480 D1238E probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pkd1l3 C T 8: 109,624,449 T642I probably damaging Het
Pkhd1l1 G A 15: 44,589,663 E3995K probably benign Het
Prdm9 A T 17: 15,544,956 Y521N probably benign Het
Prex2 A G 1: 11,184,456 S1105G probably damaging Het
Prss35 T A 9: 86,756,100 F308I probably damaging Het
Rab22a C T 2: 173,701,055 A167V probably benign Het
Rims2 A G 15: 39,566,973 Q871R possibly damaging Het
Rorb A T 19: 18,957,247 M253K probably benign Het
Ryr3 T C 2: 112,652,610 D4269G probably damaging Het
Snx11 T C 11: 96,769,906 probably benign Het
Son A G 16: 91,657,188 Q941R probably damaging Het
Sptbn2 G T 19: 4,747,785 R1880L probably benign Het
Sun1 G A 5: 139,215,259 probably null Het
Tprn A G 2: 25,264,038 R451G probably benign Het
Trbv30 T A 6: 41,281,377 M1K probably null Het
Ttn C A 2: 76,738,221 G25697W probably damaging Het
Ubb T G 11: 62,551,527 probably null Het
Unc13b C T 4: 43,239,331 R1038C probably damaging Het
Usp7 T C 16: 8,696,911 M687V probably benign Het
Zfp160 G A 17: 21,020,734 M21I probably benign Het
Zfp868 T C 8: 69,612,096 N196S probably benign Het
Zufsp A T 10: 33,928,029 I483N probably damaging Het
Other mutations in Otog
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Otog APN 7 46251282 missense probably damaging 1.00
IGL00725:Otog APN 7 46274092 missense probably damaging 1.00
IGL00757:Otog APN 7 46290128 missense probably damaging 1.00
IGL00822:Otog APN 7 46295880 missense probably benign 0.24
IGL01354:Otog APN 7 46289726 missense probably damaging 1.00
IGL01567:Otog APN 7 46276615 splice site probably benign
IGL02034:Otog APN 7 46295993 nonsense probably null
IGL02090:Otog APN 7 46300147 missense probably damaging 1.00
IGL02132:Otog APN 7 46305479 missense probably damaging 0.99
IGL02148:Otog APN 7 46300587 missense probably damaging 1.00
IGL02173:Otog APN 7 46276741 splice site probably benign
IGL02199:Otog APN 7 46277351 missense possibly damaging 0.90
IGL02216:Otog APN 7 46301468 missense probably damaging 1.00
IGL02322:Otog APN 7 46301457 missense probably benign 0.01
IGL02330:Otog APN 7 46288069 missense possibly damaging 0.84
IGL02529:Otog APN 7 46259957 missense probably damaging 0.99
IGL02898:Otog APN 7 46310138 missense probably damaging 1.00
IGL02970:Otog APN 7 46295867 missense probably benign 0.11
IGL03085:Otog APN 7 46305922 critical splice donor site probably null
IGL03108:Otog APN 7 46251338 missense probably damaging 1.00
IGL03275:Otog APN 7 46306230 missense probably damaging 1.00
I1329:Otog UTSW 7 46246503 missense probably benign 0.02
IGL02984:Otog UTSW 7 46305508 missense probably damaging 0.98
PIT4472001:Otog UTSW 7 46295849 missense probably damaging 1.00
R0032:Otog UTSW 7 46288213 nonsense probably null
R0032:Otog UTSW 7 46304231 missense probably damaging 0.97
R0105:Otog UTSW 7 46288366 missense possibly damaging 0.79
R0164:Otog UTSW 7 46304231 missense probably damaging 0.97
R0164:Otog UTSW 7 46304231 missense probably damaging 0.97
R0165:Otog UTSW 7 46304231 missense probably damaging 0.97
R0166:Otog UTSW 7 46304231 missense probably damaging 0.97
R0167:Otog UTSW 7 46304231 missense probably damaging 0.97
R0240:Otog UTSW 7 46264032 splice site probably null
R0240:Otog UTSW 7 46264032 splice site probably null
R0242:Otog UTSW 7 46267381 missense probably damaging 0.98
R0242:Otog UTSW 7 46267381 missense probably damaging 0.98
R0282:Otog UTSW 7 46277493 missense possibly damaging 0.93
R0392:Otog UTSW 7 46250075 missense probably benign 0.00
R0436:Otog UTSW 7 46265936 splice site probably benign
R0441:Otog UTSW 7 46305877 missense probably damaging 1.00
R0499:Otog UTSW 7 46273832 missense probably damaging 1.00
R0530:Otog UTSW 7 46298244 missense probably damaging 0.98
R0541:Otog UTSW 7 46269249 splice site probably benign
R0600:Otog UTSW 7 46251395 splice site probably benign
R0626:Otog UTSW 7 46271373 missense possibly damaging 0.95
R0636:Otog UTSW 7 46264228 critical splice donor site probably null
R0764:Otog UTSW 7 46300494 missense probably benign 0.00
R0833:Otog UTSW 7 46269362 missense possibly damaging 0.94
R0836:Otog UTSW 7 46269362 missense possibly damaging 0.94
R0844:Otog UTSW 7 46287828 missense possibly damaging 0.53
R1029:Otog UTSW 7 46274595 missense probably damaging 1.00
R1116:Otog UTSW 7 46300601 splice site probably benign
R1134:Otog UTSW 7 46298514 missense probably damaging 1.00
R1183:Otog UTSW 7 46289755 missense probably benign 0.41
R1204:Otog UTSW 7 46259911 missense probably benign 0.16
R1301:Otog UTSW 7 46289689 missense probably damaging 1.00
R1344:Otog UTSW 7 46274615 missense probably damaging 1.00
R1384:Otog UTSW 7 46273695 splice site probably benign
R1418:Otog UTSW 7 46274615 missense probably damaging 1.00
R1432:Otog UTSW 7 46300583 missense probably damaging 1.00
R1479:Otog UTSW 7 46295978 missense possibly damaging 0.75
R1521:Otog UTSW 7 46259264 missense possibly damaging 0.71
R1589:Otog UTSW 7 46283908 missense probably benign 0.18
R1671:Otog UTSW 7 46261786 missense probably damaging 1.00
R1773:Otog UTSW 7 46288159 missense probably benign 0.28
R1806:Otog UTSW 7 46290937 critical splice acceptor site probably null
R1843:Otog UTSW 7 46246283 missense probably damaging 1.00
R1873:Otog UTSW 7 46269343 missense probably damaging 1.00
R1923:Otog UTSW 7 46246283 missense probably damaging 1.00
R1927:Otog UTSW 7 46246283 missense probably damaging 1.00
R2008:Otog UTSW 7 46264074 missense probably benign 0.43
R2048:Otog UTSW 7 46287639 missense probably damaging 1.00
R2131:Otog UTSW 7 46250100 missense probably damaging 1.00
R2153:Otog UTSW 7 46302904 missense probably damaging 1.00
R2240:Otog UTSW 7 46241029 start codon destroyed probably null
R2278:Otog UTSW 7 46300044 missense probably damaging 1.00
R2407:Otog UTSW 7 46241540 missense probably benign 0.10
R2424:Otog UTSW 7 46298169 nonsense probably null
R2513:Otog UTSW 7 46305590 critical splice donor site probably null
R2863:Otog UTSW 7 46269306 missense probably damaging 1.00
R3148:Otog UTSW 7 46290169 missense probably damaging 1.00
R3732:Otog UTSW 7 46288368 missense probably benign 0.03
R3732:Otog UTSW 7 46288368 missense probably benign 0.03
R3733:Otog UTSW 7 46288368 missense probably benign 0.03
R3734:Otog UTSW 7 46288368 missense probably benign 0.03
R3855:Otog UTSW 7 46273760 missense possibly damaging 0.65
R3880:Otog UTSW 7 46288021 missense possibly damaging 0.93
R4081:Otog UTSW 7 46288299 missense possibly damaging 0.92
R4349:Otog UTSW 7 46274189 missense probably damaging 0.99
R4382:Otog UTSW 7 46289698 missense probably damaging 1.00
R4392:Otog UTSW 7 46285124 missense probably damaging 0.98
R4520:Otog UTSW 7 46241053 unclassified probably benign
R4569:Otog UTSW 7 46310147 missense probably damaging 1.00
R4580:Otog UTSW 7 46287801 missense possibly damaging 0.78
R4672:Otog UTSW 7 46289786 missense probably damaging 0.98
R4764:Otog UTSW 7 46288519 missense probably benign 0.29
R4910:Otog UTSW 7 46264062 missense probably damaging 1.00
R4910:Otog UTSW 7 46298534 missense probably damaging 1.00
R4913:Otog UTSW 7 46264102 missense probably benign 0.31
R4975:Otog UTSW 7 46287991 missense probably benign 0.00
R4996:Otog UTSW 7 46298606 missense possibly damaging 0.51
R4996:Otog UTSW 7 46305510 nonsense probably null
R5116:Otog UTSW 7 46273767 missense probably benign 0.34
R5138:Otog UTSW 7 46250006 missense possibly damaging 0.61
R5169:Otog UTSW 7 46298148 missense probably benign 0.06
R5239:Otog UTSW 7 46287435 missense probably benign 0.15
R5277:Otog UTSW 7 46246621 missense possibly damaging 0.89
R5287:Otog UTSW 7 46269329 missense probably damaging 0.98
R5299:Otog UTSW 7 46288851 missense probably benign 0.16
R5378:Otog UTSW 7 46255004 missense probably damaging 1.00
R5382:Otog UTSW 7 46249004 missense probably damaging 1.00
R5487:Otog UTSW 7 46288768 missense probably benign 0.27
R5507:Otog UTSW 7 46261699 missense probably damaging 1.00
R5517:Otog UTSW 7 46274571 missense probably damaging 1.00
R5643:Otog UTSW 7 46287447 missense probably damaging 1.00
R5757:Otog UTSW 7 46241121 critical splice donor site probably null
R5910:Otog UTSW 7 46298598 missense possibly damaging 0.94
R6019:Otog UTSW 7 46288950 missense probably benign 0.00
R6150:Otog UTSW 7 46264059 missense possibly damaging 0.82
R6225:Otog UTSW 7 46249034 missense possibly damaging 0.67
R6271:Otog UTSW 7 46252040 missense probably damaging 1.00
R6317:Otog UTSW 7 46301215 missense probably damaging 1.00
R6454:Otog UTSW 7 46305817 missense probably damaging 1.00
R6640:Otog UTSW 7 46261743 missense possibly damaging 0.92
R6788:Otog UTSW 7 46298317 missense probably damaging 1.00
R6859:Otog UTSW 7 46273781 missense probably damaging 0.96
R7033:Otog UTSW 7 46267398 critical splice donor site probably null
R7071:Otog UTSW 7 46267323 missense probably damaging 1.00
R7084:Otog UTSW 7 46298566 nonsense probably null
R7116:Otog UTSW 7 46298265 missense probably damaging 0.99
R7202:Otog UTSW 7 46288050 missense probably damaging 0.97
R7365:Otog UTSW 7 46298308 missense probably damaging 1.00
R7468:Otog UTSW 7 46264119 missense probably benign
R7475:Otog UTSW 7 46267276 missense probably damaging 0.99
X0062:Otog UTSW 7 46259921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGCCGTGTTGGAGAAAG -3'
(R):5'- ACACACAGGCCAGGTTTGTG -3'

Sequencing Primer
(F):5'- ATGGGGCCACACGATCATC -3'
(R):5'- GTGTTTCTGCCCCAAGGTAG -3'
Posted On2018-08-01