Incidental Mutation 'R6753:Jaml'
ID530902
Institutional Source Beutler Lab
Gene Symbol Jaml
Ensembl Gene ENSMUSG00000048534
Gene Namejunction adhesion molecule like
SynonymsLOC270152, Amica1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6753 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location45079183-45108534 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45107379 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 359 (N359D)
Ref Sequence ENSEMBL: ENSMUSP00000150697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050020] [ENSMUST00000215880]
Predicted Effect probably benign
Transcript: ENSMUST00000050020
AA Change: N359D

PolyPhen 2 Score 0.425 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000052033
Gene: ENSMUSG00000048534
AA Change: N359D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 30 139 5.7e-8 SMART
IG 143 254 9.26e-8 SMART
low complexity region 293 304 N/A INTRINSIC
low complexity region 309 320 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215266
Predicted Effect probably benign
Transcript: ENSMUST00000215880
AA Change: N359D

PolyPhen 2 Score 0.425 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect unknown
Transcript: ENSMUST00000217074
AA Change: N92D
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217151
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 120,010,151 P1083S probably benign Het
Abcb5 T A 12: 118,944,906 N101I possibly damaging Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Agk T A 6: 40,368,570 probably null Het
Akap10 A T 11: 61,886,777 M586K probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Armc1 A G 3: 19,144,398 F133L possibly damaging Het
Bank1 T C 3: 136,093,308 E424G probably damaging Het
Cacna1a A G 8: 84,580,205 E1363G probably damaging Het
Cacna1d C A 14: 30,042,786 A2076S probably damaging Het
Ccdc73 T A 2: 104,991,524 L606* probably null Het
Ccdc8 C T 7: 16,996,637 Q684* probably null Het
Ces1b T A 8: 93,067,020 K314* probably null Het
Ces1e T A 8: 93,215,128 N238I probably damaging Het
Chd4 A G 6: 125,114,300 N1238S probably benign Het
Cmtr2 T A 8: 110,222,979 D640E probably damaging Het
Col7a1 C T 9: 108,958,128 T559I unknown Het
Comt T C 16: 18,408,021 K205R probably benign Het
Dbp A T 7: 45,708,404 E232V probably damaging Het
Dcbld2 A G 16: 58,456,130 T470A possibly damaging Het
Eml6 T A 11: 29,754,987 D1519V probably damaging Het
Evpl T A 11: 116,237,906 H31L possibly damaging Het
Exoc1 T A 5: 76,563,339 I86N probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fgfr3 T C 5: 33,732,159 S301P probably benign Het
Gas2l1 C T 11: 5,064,254 V69I probably damaging Het
Gm2042 T A 12: 87,958,084 I107K probably damaging Het
Gucy1b1 T C 3: 82,039,747 D385G probably null Het
Ints1 T A 5: 139,765,175 E824D probably damaging Het
Itfg1 T C 8: 85,835,078 D142G probably benign Het
Kcnh7 T A 2: 62,850,377 I289L probably benign Het
Klf12 G A 14: 100,109,776 Q40* probably null Het
Mcm4 A C 16: 15,629,362 N579K possibly damaging Het
Mfsd2b A T 12: 4,867,358 F179I possibly damaging Het
Mmp11 C T 10: 75,928,374 V86M probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otog A C 7: 46,249,071 E204D probably benign Het
Parp8 G A 13: 116,895,115 H354Y possibly damaging Het
Pcnx C A 12: 81,964,480 D1238E probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pkd1l3 C T 8: 109,624,449 T642I probably damaging Het
Pkhd1l1 G A 15: 44,589,663 E3995K probably benign Het
Prdm9 A T 17: 15,544,956 Y521N probably benign Het
Prex2 A G 1: 11,184,456 S1105G probably damaging Het
Prss35 T A 9: 86,756,100 F308I probably damaging Het
Rab22a C T 2: 173,701,055 A167V probably benign Het
Rims2 A G 15: 39,566,973 Q871R possibly damaging Het
Rorb A T 19: 18,957,247 M253K probably benign Het
Ryr3 T C 2: 112,652,610 D4269G probably damaging Het
Snx11 T C 11: 96,769,906 probably benign Het
Son A G 16: 91,657,188 Q941R probably damaging Het
Sptbn2 G T 19: 4,747,785 R1880L probably benign Het
Sun1 G A 5: 139,215,259 probably null Het
Tprn A G 2: 25,264,038 R451G probably benign Het
Trbv30 T A 6: 41,281,377 M1K probably null Het
Ttn C A 2: 76,738,221 G25697W probably damaging Het
Ubb T G 11: 62,551,527 probably null Het
Unc13b C T 4: 43,239,331 R1038C probably damaging Het
Usp7 T C 16: 8,696,911 M687V probably benign Het
Zfp160 G A 17: 21,020,734 M21I probably benign Het
Zfp868 T C 8: 69,612,096 N196S probably benign Het
Zufsp A T 10: 33,928,029 I483N probably damaging Het
Other mutations in Jaml
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Jaml APN 9 45100989 unclassified probably benign
IGL00771:Jaml APN 9 45093807 missense possibly damaging 0.94
IGL01139:Jaml APN 9 45101019 missense possibly damaging 0.91
IGL02669:Jaml APN 9 45104191 missense possibly damaging 0.68
IGL03405:Jaml APN 9 45093809 missense possibly damaging 0.61
R0207:Jaml UTSW 9 45093767 missense probably benign 0.01
R1962:Jaml UTSW 9 45104197 missense possibly damaging 0.80
R2119:Jaml UTSW 9 45101064 missense probably damaging 1.00
R2120:Jaml UTSW 9 45101064 missense probably damaging 1.00
R2124:Jaml UTSW 9 45101064 missense probably damaging 1.00
R2358:Jaml UTSW 9 45101063 missense possibly damaging 0.95
R3917:Jaml UTSW 9 45101151 unclassified probably benign
R4801:Jaml UTSW 9 45101064 missense possibly damaging 0.57
R4802:Jaml UTSW 9 45101064 missense possibly damaging 0.57
R5224:Jaml UTSW 9 45104266 missense probably damaging 1.00
R5739:Jaml UTSW 9 45088728 missense probably damaging 1.00
R5760:Jaml UTSW 9 45097754 missense probably benign 0.02
R6033:Jaml UTSW 9 45088710 missense probably damaging 1.00
R6033:Jaml UTSW 9 45088710 missense probably damaging 1.00
R6174:Jaml UTSW 9 45088773 missense probably damaging 1.00
R6245:Jaml UTSW 9 45097919 missense probably damaging 1.00
R6797:Jaml UTSW 9 45088760 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAGTGAAAGGCTGCTAC -3'
(R):5'- CGTCTTCAGCCTTTTGATGG -3'

Sequencing Primer
(F):5'- tgctaagccttatcccca -3'
(R):5'- GAAATTCCCCAAGGTGAC -3'
Posted On2018-08-01