Incidental Mutation 'R6753:Evpl'
ID530912
Institutional Source Beutler Lab
Gene Symbol Evpl
Ensembl Gene ENSMUSG00000034282
Gene Nameenvoplakin
Synonyms210kDa protein
MMRRC Submission
Accession Numbers

Genbank: NM_025276; MGI: 107507

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6753 (G1)
Quality Score95.0077
Status Validated
Chromosome11
Chromosomal Location116220559-116238077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116237906 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 31 (H31L)
Ref Sequence ENSEMBL: ENSMUSP00000037850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037007]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037007
AA Change: H31L

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000037850
Gene: ENSMUSG00000034282
AA Change: H31L

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
Blast:SPEC 44 140 1e-16 BLAST
Blast:SPEC 140 226 4e-46 BLAST
SPEC 229 330 2.21e-6 SMART
Blast:SPEC 336 500 7e-68 BLAST
low complexity region 508 525 N/A INTRINSIC
Blast:SPEC 527 632 4e-41 BLAST
Blast:SPEC 635 746 5e-48 BLAST
Blast:SPEC 753 867 7e-49 BLAST
low complexity region 868 881 N/A INTRINSIC
low complexity region 933 950 N/A INTRINSIC
internal_repeat_2 1011 1030 6.54e-6 PROSPERO
internal_repeat_3 1012 1032 1.94e-5 PROSPERO
coiled coil region 1035 1077 N/A INTRINSIC
low complexity region 1131 1144 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
PLEC 1186 1227 1.48e2 SMART
low complexity region 1228 1242 N/A INTRINSIC
coiled coil region 1262 1366 N/A INTRINSIC
low complexity region 1398 1414 N/A INTRINSIC
internal_repeat_2 1457 1476 6.54e-6 PROSPERO
internal_repeat_3 1516 1536 1.94e-5 PROSPERO
low complexity region 1595 1617 N/A INTRINSIC
PLEC 1679 1714 9.19e-4 SMART
PLEC 1729 1764 4.53e1 SMART
low complexity region 1788 1800 N/A INTRINSIC
PLEC 1819 1856 1.41e-4 SMART
PLEC 1857 1894 5.4e-10 SMART
PLEC 1895 1932 2.7e-10 SMART
PLEC 1933 1970 1.21e-3 SMART
PLEC 1971 2008 1.16e0 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plakin family of proteins that forms a component of desmosomes and the epidermal cornified envelope. This gene is located in the tylosis oesophageal cancer locus on chromosome 17q25, and its deletion is associated with both familial and sporadic forms of oesophageal squamous cell carcinoma. Patients suffering from the autoimmune mucocutaneous disorder, paraneoplastic pemphigus, develop antibodies against the encoded protein. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted deletion of this gene are viable and fertile. Surprisingly, cornified envelope assembly is not inhibited and adult homozygotes show no obvious pathological phenotype in skin or other epithelia, despite a slight delay in barrier acquisition during embryonic development. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(3)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 120,010,151 P1083S probably benign Het
Abcb5 T A 12: 118,944,906 N101I possibly damaging Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Agk T A 6: 40,368,570 probably null Het
Akap10 A T 11: 61,886,777 M586K probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Armc1 A G 3: 19,144,398 F133L possibly damaging Het
Bank1 T C 3: 136,093,308 E424G probably damaging Het
Cacna1a A G 8: 84,580,205 E1363G probably damaging Het
Cacna1d C A 14: 30,042,786 A2076S probably damaging Het
Ccdc73 T A 2: 104,991,524 L606* probably null Het
Ccdc8 C T 7: 16,996,637 Q684* probably null Het
Ces1b T A 8: 93,067,020 K314* probably null Het
Ces1e T A 8: 93,215,128 N238I probably damaging Het
Chd4 A G 6: 125,114,300 N1238S probably benign Het
Cmtr2 T A 8: 110,222,979 D640E probably damaging Het
Col7a1 C T 9: 108,958,128 T559I unknown Het
Comt T C 16: 18,408,021 K205R probably benign Het
Dbp A T 7: 45,708,404 E232V probably damaging Het
Dcbld2 A G 16: 58,456,130 T470A possibly damaging Het
Eml6 T A 11: 29,754,987 D1519V probably damaging Het
Exoc1 T A 5: 76,563,339 I86N probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fgfr3 T C 5: 33,732,159 S301P probably benign Het
Gas2l1 C T 11: 5,064,254 V69I probably damaging Het
Gm2042 T A 12: 87,958,084 I107K probably damaging Het
Gucy1b1 T C 3: 82,039,747 D385G probably null Het
Ints1 T A 5: 139,765,175 E824D probably damaging Het
Itfg1 T C 8: 85,835,078 D142G probably benign Het
Jaml A G 9: 45,107,379 N359D probably benign Het
Kcnh7 T A 2: 62,850,377 I289L probably benign Het
Klf12 G A 14: 100,109,776 Q40* probably null Het
Mcm4 A C 16: 15,629,362 N579K possibly damaging Het
Mfsd2b A T 12: 4,867,358 F179I possibly damaging Het
Mmp11 C T 10: 75,928,374 V86M probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otog A C 7: 46,249,071 E204D probably benign Het
Parp8 G A 13: 116,895,115 H354Y possibly damaging Het
Pcnx C A 12: 81,964,480 D1238E probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pkd1l3 C T 8: 109,624,449 T642I probably damaging Het
Pkhd1l1 G A 15: 44,589,663 E3995K probably benign Het
Prdm9 A T 17: 15,544,956 Y521N probably benign Het
Prex2 A G 1: 11,184,456 S1105G probably damaging Het
Prss35 T A 9: 86,756,100 F308I probably damaging Het
Rab22a C T 2: 173,701,055 A167V probably benign Het
Rims2 A G 15: 39,566,973 Q871R possibly damaging Het
Rorb A T 19: 18,957,247 M253K probably benign Het
Ryr3 T C 2: 112,652,610 D4269G probably damaging Het
Snx11 T C 11: 96,769,906 probably benign Het
Son A G 16: 91,657,188 Q941R probably damaging Het
Sptbn2 G T 19: 4,747,785 R1880L probably benign Het
Sun1 G A 5: 139,215,259 probably null Het
Tprn A G 2: 25,264,038 R451G probably benign Het
Trbv30 T A 6: 41,281,377 M1K probably null Het
Ttn C A 2: 76,738,221 G25697W probably damaging Het
Ubb T G 11: 62,551,527 probably null Het
Unc13b C T 4: 43,239,331 R1038C probably damaging Het
Usp7 T C 16: 8,696,911 M687V probably benign Het
Zfp160 G A 17: 21,020,734 M21I probably benign Het
Zfp868 T C 8: 69,612,096 N196S probably benign Het
Zufsp A T 10: 33,928,029 I483N probably damaging Het
Other mutations in Evpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Evpl APN 11 116234505 missense probably benign 0.01
IGL00896:Evpl APN 11 116222584 nonsense probably null
IGL00941:Evpl APN 11 116227901 missense probably benign 0.06
IGL01443:Evpl APN 11 116222454 missense probably damaging 1.00
IGL01523:Evpl APN 11 116233444 missense probably damaging 1.00
IGL01957:Evpl APN 11 116223222 missense probably damaging 1.00
IGL02124:Evpl APN 11 116227015 missense probably benign 0.01
IGL02334:Evpl APN 11 116231024 nonsense probably null
IGL02457:Evpl APN 11 116230113 missense possibly damaging 0.87
IGL02502:Evpl APN 11 116222718 missense probably damaging 1.00
IGL02536:Evpl APN 11 116221209 missense probably damaging 1.00
IGL02948:Evpl APN 11 116221822 missense probably damaging 1.00
IGL03183:Evpl APN 11 116221612 missense probably damaging 0.98
IGL03405:Evpl APN 11 116227927 missense possibly damaging 0.89
A4554:Evpl UTSW 11 116220834 missense probably damaging 1.00
PIT4449001:Evpl UTSW 11 116233399 missense possibly damaging 0.87
R0082:Evpl UTSW 11 116235003 missense probably damaging 1.00
R0108:Evpl UTSW 11 116220876 missense probably damaging 1.00
R0514:Evpl UTSW 11 116223291 missense probably damaging 0.99
R0581:Evpl UTSW 11 116229490 missense probably benign 0.02
R0727:Evpl UTSW 11 116232485 missense probably damaging 1.00
R0791:Evpl UTSW 11 116227723 missense probably damaging 1.00
R0792:Evpl UTSW 11 116227723 missense probably damaging 1.00
R1079:Evpl UTSW 11 116230068 missense possibly damaging 0.48
R1514:Evpl UTSW 11 116223835 missense probably benign
R1699:Evpl UTSW 11 116227588 missense probably damaging 1.00
R1717:Evpl UTSW 11 116225492 missense probably benign 0.06
R1775:Evpl UTSW 11 116223660 missense possibly damaging 0.66
R1886:Evpl UTSW 11 116227576 missense probably damaging 0.97
R1903:Evpl UTSW 11 116227028 missense probably damaging 1.00
R2081:Evpl UTSW 11 116234266 missense probably damaging 1.00
R2137:Evpl UTSW 11 116221839 missense probably damaging 0.99
R2571:Evpl UTSW 11 116237969 missense unknown
R3081:Evpl UTSW 11 116220852 missense probably damaging 1.00
R4097:Evpl UTSW 11 116223177 missense possibly damaging 0.89
R4541:Evpl UTSW 11 116232644 missense probably benign 0.01
R4562:Evpl UTSW 11 116233399 missense possibly damaging 0.87
R4703:Evpl UTSW 11 116222505 missense probably damaging 0.98
R4947:Evpl UTSW 11 116223375 missense possibly damaging 0.88
R5243:Evpl UTSW 11 116222969 missense probably damaging 1.00
R5325:Evpl UTSW 11 116221365 missense probably damaging 1.00
R5416:Evpl UTSW 11 116234259 missense probably benign 0.13
R5580:Evpl UTSW 11 116234232 missense probably benign 0.14
R5873:Evpl UTSW 11 116234432 missense probably damaging 1.00
R6298:Evpl UTSW 11 116230922 missense probably damaging 1.00
R6438:Evpl UTSW 11 116230101 missense probably benign 0.00
R6742:Evpl UTSW 11 116222814 missense possibly damaging 0.80
R6764:Evpl UTSW 11 116222944 missense probably damaging 0.99
R6846:Evpl UTSW 11 116223807 missense probably damaging 1.00
R7278:Evpl UTSW 11 116223113 missense probably damaging 1.00
R7288:Evpl UTSW 11 116223949 missense probably benign
R7395:Evpl UTSW 11 116227079 missense possibly damaging 0.94
R7441:Evpl UTSW 11 116222956 nonsense probably null
R7505:Evpl UTSW 11 116226987 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCAGGCTATCCATCCCTTG -3'
(R):5'- ACAAGTCCAAACCTCCGTGG -3'

Sequencing Primer
(F):5'- ATCCCTTGCTCAACCTGGG -3'
(R):5'- TCCCAGACTGGTTGTGCAG -3'
Posted On2018-08-01