Incidental Mutation 'R6753:Narf'
ID530914
Institutional Source Beutler Lab
Gene Symbol Narf
Ensembl Gene ENSMUSG00000000056
Gene Namenuclear prelamin A recognition factor
Synonyms4430402O11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6753 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location121237253-121255856 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121242626 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 84 (H84Q)
Ref Sequence ENSEMBL: ENSMUSP00000099304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103015]
Predicted Effect probably benign
Transcript: ENSMUST00000103015
AA Change: H84Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099304
Gene: ENSMUSG00000000056
AA Change: H84Q

DomainStartEndE-ValueType
Pfam:Fe_hyd_lg_C 98 391 1e-75 PFAM
Fe_hyd_SSU 396 452 5.66e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151088
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154047
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Several proteins have been found to be prenylated and methylated at their carboxyl-terminal ends. Prenylation was initially believed to be important only for membrane attachment. However, another role for prenylation appears to be its importance in protein-protein interactions. The only nuclear proteins known to be prenylated in mammalian cells are prelamin A- and B-type lamins. Prelamin A is farnesylated and carboxymethylated on the cysteine residue of a carboxyl-terminal CaaX motif. This post-translationally modified cysteine residue is removed from prelamin A when it is endoproteolytically processed into mature lamin A. The protein encoded by this gene binds to the prenylated prelamin A carboxyl-terminal tail domain. It may be a component of a prelamin A endoprotease complex. The encoded protein is located in the nucleus, where it partially colocalizes with the nuclear lamina. It shares limited sequence similarity with iron-only bacterial hydrogenases. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene, including one with a novel exon that is generated by RNA editing. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 120,010,151 P1083S probably benign Het
Abcb5 T A 12: 118,944,906 N101I possibly damaging Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Agk T A 6: 40,368,570 probably null Het
Akap10 A T 11: 61,886,777 M586K probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Armc1 A G 3: 19,144,398 F133L possibly damaging Het
Bank1 T C 3: 136,093,308 E424G probably damaging Het
Cacna1a A G 8: 84,580,205 E1363G probably damaging Het
Cacna1d C A 14: 30,042,786 A2076S probably damaging Het
Ccdc73 T A 2: 104,991,524 L606* probably null Het
Ccdc8 C T 7: 16,996,637 Q684* probably null Het
Ces1b T A 8: 93,067,020 K314* probably null Het
Ces1e T A 8: 93,215,128 N238I probably damaging Het
Chd4 A G 6: 125,114,300 N1238S probably benign Het
Cmtr2 T A 8: 110,222,979 D640E probably damaging Het
Col7a1 C T 9: 108,958,128 T559I unknown Het
Comt T C 16: 18,408,021 K205R probably benign Het
Dbp A T 7: 45,708,404 E232V probably damaging Het
Dcbld2 A G 16: 58,456,130 T470A possibly damaging Het
Eml6 T A 11: 29,754,987 D1519V probably damaging Het
Evpl T A 11: 116,237,906 H31L possibly damaging Het
Exoc1 T A 5: 76,563,339 I86N probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fgfr3 T C 5: 33,732,159 S301P probably benign Het
Gas2l1 C T 11: 5,064,254 V69I probably damaging Het
Gm2042 T A 12: 87,958,084 I107K probably damaging Het
Gucy1b1 T C 3: 82,039,747 D385G probably null Het
Ints1 T A 5: 139,765,175 E824D probably damaging Het
Itfg1 T C 8: 85,835,078 D142G probably benign Het
Jaml A G 9: 45,107,379 N359D probably benign Het
Kcnh7 T A 2: 62,850,377 I289L probably benign Het
Klf12 G A 14: 100,109,776 Q40* probably null Het
Mcm4 A C 16: 15,629,362 N579K possibly damaging Het
Mfsd2b A T 12: 4,867,358 F179I possibly damaging Het
Mmp11 C T 10: 75,928,374 V86M probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otog A C 7: 46,249,071 E204D probably benign Het
Parp8 G A 13: 116,895,115 H354Y possibly damaging Het
Pcnx C A 12: 81,964,480 D1238E probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pkd1l3 C T 8: 109,624,449 T642I probably damaging Het
Pkhd1l1 G A 15: 44,589,663 E3995K probably benign Het
Prdm9 A T 17: 15,544,956 Y521N probably benign Het
Prex2 A G 1: 11,184,456 S1105G probably damaging Het
Prss35 T A 9: 86,756,100 F308I probably damaging Het
Rab22a C T 2: 173,701,055 A167V probably benign Het
Rims2 A G 15: 39,566,973 Q871R possibly damaging Het
Rorb A T 19: 18,957,247 M253K probably benign Het
Ryr3 T C 2: 112,652,610 D4269G probably damaging Het
Snx11 T C 11: 96,769,906 probably benign Het
Son A G 16: 91,657,188 Q941R probably damaging Het
Sptbn2 G T 19: 4,747,785 R1880L probably benign Het
Sun1 G A 5: 139,215,259 probably null Het
Tprn A G 2: 25,264,038 R451G probably benign Het
Trbv30 T A 6: 41,281,377 M1K probably null Het
Ttn C A 2: 76,738,221 G25697W probably damaging Het
Ubb T G 11: 62,551,527 probably null Het
Unc13b C T 4: 43,239,331 R1038C probably damaging Het
Usp7 T C 16: 8,696,911 M687V probably benign Het
Zfp160 G A 17: 21,020,734 M21I probably benign Het
Zfp868 T C 8: 69,612,096 N196S probably benign Het
Zufsp A T 10: 33,928,029 I483N probably damaging Het
Other mutations in Narf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Narf APN 11 121238518 critical splice donor site probably null
R0128:Narf UTSW 11 121250836 missense probably damaging 1.00
R0542:Narf UTSW 11 121252864 missense probably damaging 1.00
R1326:Narf UTSW 11 121242553 missense probably damaging 1.00
R2035:Narf UTSW 11 121238500 missense probably benign 0.00
R2049:Narf UTSW 11 121250369 nonsense probably null
R2078:Narf UTSW 11 121245394 missense probably benign 0.03
R3711:Narf UTSW 11 121246938 nonsense probably null
R3967:Narf UTSW 11 121238421 missense possibly damaging 0.92
R3968:Narf UTSW 11 121238421 missense possibly damaging 0.92
R3970:Narf UTSW 11 121238421 missense possibly damaging 0.92
R4128:Narf UTSW 11 121250435 splice site probably null
R4913:Narf UTSW 11 121244643 missense probably damaging 1.00
R4928:Narf UTSW 11 121244939 missense possibly damaging 0.87
R4946:Narf UTSW 11 121250353 missense possibly damaging 0.71
R5404:Narf UTSW 11 121242626 missense probably benign 0.00
R5799:Narf UTSW 11 121244654 missense probably damaging 1.00
R6912:Narf UTSW 11 121238461 missense probably benign 0.00
R7311:Narf UTSW 11 121249150 missense probably benign 0.31
X0011:Narf UTSW 11 121250872 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATCCCTAAAGAAGCAATGCT -3'
(R):5'- AGAACCCTGTATGTATTTATCTACTCA -3'

Sequencing Primer
(F):5'- AGCCGGGCAGTACCTTTAATC -3'
(R):5'- ATCCTGGGTTCTGTAAGAAAGC -3'
Posted On2018-08-01