Mutagenetix > Incidental Mutation

Incidental Mutation 'R6753:Mcm4'

530925

Institutional Source

Beutler Lab

Gene Symbol

Mcm4

Ensembl Gene

ENSMUSG00000022673

Gene Name

minichromosome maintenance complex component 4

Synonyms

mCdc21, Mcmd4, 19G, Cdc21

MMRRC Submission

044870-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6753 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

15441761-15455264 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 15447226 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 579 (N579K)

Ref Sequence

ENSEMBL: ENSMUSP00000023353 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023353]

AlphaFold

P49717

Predicted Effect

possibly damaging
Transcript: ENSMUST00000023353
AA Change: N579K

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000023353
Gene: ENSMUSG00000022673
AA Change: N579K

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
low complexity region	23	40	N/A	INTRINSIC
MCM	266	769	N/A	SMART
AAA	501	653	7.04e-3	SMART
Blast:MCM	781	849	3e-11	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000229606

Predicted Effect

probably benign
Transcript: ENSMUST00000230437

Meta Mutation Damage Score

0.2294

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.1%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 6 and 7 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. The phosphorylation of this protein by CDC2 kinase reduces the DNA helicase activity and chromatin binding of the MCM complex. This gene is mapped to a region on the chromosome 8 head-to-head next to the PRKDC/DNA-PK, a DNA-activated protein kinase involved in the repair of DNA double-strand breaks. Alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this allele cause chromosomal instability as assessed by micronucleus levels in erythrocytes. Mice homozygous for a spontaneous allele exhibit early onset T cell acute lymphoblastic leukemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	G	A	11: 119,900,977 (GRCm39)	P1083S	probably benign	Het
Abcb5	T	A	12: 118,908,641 (GRCm39)	N101I	possibly damaging	Het
Adrb2	A	G	18: 62,312,624 (GRCm39)	V67A	possibly damaging	Het
Agk	T	A	6: 40,345,504 (GRCm39)		probably null	Het
Akap10	A	T	11: 61,777,603 (GRCm39)	M586K	probably damaging	Het
Akt3	A	T	1: 176,877,756 (GRCm39)	Y337*	probably null	Het
Armc1	A	G	3: 19,198,562 (GRCm39)	F133L	possibly damaging	Het
Bank1	T	C	3: 135,799,069 (GRCm39)	E424G	probably damaging	Het
Cacna1a	A	G	8: 85,306,834 (GRCm39)	E1363G	probably damaging	Het
Cacna1d	C	A	14: 29,764,743 (GRCm39)	A2076S	probably damaging	Het
Ccdc73	T	A	2: 104,821,869 (GRCm39)	L606*	probably null	Het
Ccdc8	C	T	7: 16,730,562 (GRCm39)	Q684*	probably null	Het
Ces1b	T	A	8: 93,793,648 (GRCm39)	K314*	probably null	Het
Ces1e	T	A	8: 93,941,756 (GRCm39)	N238I	probably damaging	Het
Chd4	A	G	6: 125,091,263 (GRCm39)	N1238S	probably benign	Het
Cmtr2	T	A	8: 110,949,611 (GRCm39)	D640E	probably damaging	Het
Col7a1	C	T	9: 108,787,196 (GRCm39)	T559I	unknown	Het
Comt	T	C	16: 18,226,771 (GRCm39)	K205R	probably benign	Het
Dbp	A	T	7: 45,357,828 (GRCm39)	E232V	probably damaging	Het
Dcbld2	A	G	16: 58,276,493 (GRCm39)	T470A	possibly damaging	Het
Eml6	T	A	11: 29,704,987 (GRCm39)	D1519V	probably damaging	Het
Evpl	T	A	11: 116,128,732 (GRCm39)	H31L	possibly damaging	Het
Exoc1	T	A	5: 76,711,186 (GRCm39)	I86N	probably damaging	Het
Fat3	C	T	9: 15,826,357 (GRCm39)	E4532K	possibly damaging	Het
Fgfr3	T	C	5: 33,889,503 (GRCm39)	S301P	probably benign	Het
Gas2l1	C	T	11: 5,014,254 (GRCm39)	V69I	probably damaging	Het
Gm2042	T	A	12: 87,924,854 (GRCm39)	I107K	probably damaging	Het
Gucy1b1	T	C	3: 81,947,054 (GRCm39)	D385G	probably null	Het
Ints1	T	A	5: 139,750,930 (GRCm39)	E824D	probably damaging	Het
Itfg1	T	C	8: 86,561,707 (GRCm39)	D142G	probably benign	Het
Jaml	A	G	9: 45,018,677 (GRCm39)	N359D	probably benign	Het
Kcnh7	T	A	2: 62,680,721 (GRCm39)	I289L	probably benign	Het
Klf12	G	A	14: 100,347,212 (GRCm39)	Q40*	probably null	Het
Mfsd2b	A	T	12: 4,917,358 (GRCm39)	F179I	possibly damaging	Het
Mmp11	C	T	10: 75,764,208 (GRCm39)	V86M	probably damaging	Het
Mogs	T	C	6: 83,092,863 (GRCm39)	V101A	probably damaging	Het
Narf	T	A	11: 121,133,452 (GRCm39)	H84Q	probably benign	Het
Or5ak4	C	A	2: 85,162,142 (GRCm39)	M33I	probably benign	Het
Otog	A	C	7: 45,898,495 (GRCm39)	E204D	probably benign	Het
Parp8	G	A	13: 117,031,651 (GRCm39)	H354Y	possibly damaging	Het
Pcnx1	C	A	12: 82,011,254 (GRCm39)	D1238E	probably damaging	Het
Pi4ka	A	G	16: 17,194,846 (GRCm39)	L184P	possibly damaging	Het
Pkd1l3	C	T	8: 110,351,081 (GRCm39)	T642I	probably damaging	Het
Pkhd1l1	G	A	15: 44,453,059 (GRCm39)	E3995K	probably benign	Het
Prdm9	A	T	17: 15,765,218 (GRCm39)	Y521N	probably benign	Het
Prex2	A	G	1: 11,254,680 (GRCm39)	S1105G	probably damaging	Het
Prss35	T	A	9: 86,638,153 (GRCm39)	F308I	probably damaging	Het
Rab22a	C	T	2: 173,542,848 (GRCm39)	A167V	probably benign	Het
Rims2	A	G	15: 39,430,369 (GRCm39)	Q871R	possibly damaging	Het
Rorb	A	T	19: 18,934,611 (GRCm39)	M253K	probably benign	Het
Ryr3	T	C	2: 112,482,955 (GRCm39)	D4269G	probably damaging	Het
Snx11	T	C	11: 96,660,732 (GRCm39)		probably benign	Het
Son	A	G	16: 91,454,076 (GRCm39)	Q941R	probably damaging	Het
Sptbn2	G	T	19: 4,797,813 (GRCm39)	R1880L	probably benign	Het
Sun1	G	A	5: 139,201,014 (GRCm39)		probably null	Het
Tprn	A	G	2: 25,154,050 (GRCm39)	R451G	probably benign	Het
Trbv30	T	A	6: 41,258,311 (GRCm39)	M1K	probably null	Het
Ttn	C	A	2: 76,568,565 (GRCm39)	G25697W	probably damaging	Het
Ubb	T	G	11: 62,442,353 (GRCm39)		probably null	Het
Unc13b	C	T	4: 43,239,331 (GRCm39)	R1038C	probably damaging	Het
Usp7	T	C	16: 8,514,775 (GRCm39)	M687V	probably benign	Het
Zfp160	G	A	17: 21,240,996 (GRCm39)	M21I	probably benign	Het
Zfp868	T	C	8: 70,064,747 (GRCm39)	N196S	probably benign	Het
Zup1	A	T	10: 33,804,025 (GRCm39)	I483N	probably damaging	Het

Other mutations in Mcm4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01823:Mcm4	APN	16	15,443,995 (GRCm39)	missense	probably damaging	1.00
IGL01982:Mcm4	APN	16	15,448,284 (GRCm39)	missense	possibly damaging	0.57
IGL02382:Mcm4	APN	16	15,442,602 (GRCm39)	missense	probably damaging	1.00
PIT4687001:Mcm4	UTSW	16	15,454,577 (GRCm39)	missense	probably benign	0.01
R0200:Mcm4	UTSW	16	15,447,503 (GRCm39)	missense	probably benign	0.41
R0540:Mcm4	UTSW	16	15,449,979 (GRCm39)	critical splice donor site	probably null
R0607:Mcm4	UTSW	16	15,449,979 (GRCm39)	critical splice donor site	probably null
R2064:Mcm4	UTSW	16	15,452,333 (GRCm39)	missense	possibly damaging	0.75
R4240:Mcm4	UTSW	16	15,445,570 (GRCm39)	nonsense	probably null
R4604:Mcm4	UTSW	16	15,447,527 (GRCm39)	missense	probably damaging	1.00
R4871:Mcm4	UTSW	16	15,452,374 (GRCm39)	nonsense	probably null
R5070:Mcm4	UTSW	16	15,443,434 (GRCm39)	missense	probably damaging	1.00
R5125:Mcm4	UTSW	16	15,453,167 (GRCm39)	missense	probably benign	0.21
R5178:Mcm4	UTSW	16	15,453,167 (GRCm39)	missense	probably benign	0.21
R5245:Mcm4	UTSW	16	15,448,289 (GRCm39)	missense	probably benign	0.02
R5513:Mcm4	UTSW	16	15,448,378 (GRCm39)	missense	probably benign	0.26
R5696:Mcm4	UTSW	16	15,443,434 (GRCm39)	missense	probably damaging	1.00
R6453:Mcm4	UTSW	16	15,448,273 (GRCm39)	missense	probably damaging	1.00
R6909:Mcm4	UTSW	16	15,446,561 (GRCm39)	missense	probably damaging	1.00
R6937:Mcm4	UTSW	16	15,454,199 (GRCm39)	missense	probably benign
R7402:Mcm4	UTSW	16	15,455,042 (GRCm39)	start codon destroyed	probably null
R7483:Mcm4	UTSW	16	15,448,306 (GRCm39)	missense	probably benign	0.05
R8275:Mcm4	UTSW	16	15,452,435 (GRCm39)	missense	probably damaging	0.98
R8487:Mcm4	UTSW	16	15,450,042 (GRCm39)	missense	probably damaging	1.00
R8683:Mcm4	UTSW	16	15,453,138 (GRCm39)	missense	probably damaging	0.99
R8742:Mcm4	UTSW	16	15,443,430 (GRCm39)	missense	possibly damaging	0.52
R8929:Mcm4	UTSW	16	15,448,289 (GRCm39)	missense	probably benign	0.02
R9138:Mcm4	UTSW	16	15,447,200 (GRCm39)	missense	probably damaging	1.00
R9440:Mcm4	UTSW	16	15,453,175 (GRCm39)	nonsense	probably null
Z1177:Mcm4	UTSW	16	15,450,080 (GRCm39)	missense	possibly damaging	0.55
Z1177:Mcm4	UTSW	16	15,447,318 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGATTCACGTCTAAGATTGAGC -3'
(R):5'- ATGTGTACAACCTGGTCCCC -3'

Sequencing Primer
(F):5'- CCTTTGGAACTGCAGTTACCGAAG -3'
(R):5'- CAGAGGCCAGTACACGTCTG -3'

Posted On

2018-08-01