Incidental Mutation 'R6754:F5'
ID530938
Institutional Source Beutler Lab
Gene Symbol F5
Ensembl Gene ENSMUSG00000026579
Gene Namecoagulation factor V
SynonymsCf-5, Cf5
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6754 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location164151838-164220277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164193763 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1269 (D1269G)
Ref Sequence ENSEMBL: ENSMUSP00000083204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086040]
Predicted Effect probably damaging
Transcript: ENSMUST00000086040
AA Change: D1269G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083204
Gene: ENSMUSG00000026579
AA Change: D1269G

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Cu-oxidase_3 67 196 4.4e-10 PFAM
low complexity region 282 300 N/A INTRINSIC
Pfam:Cu-oxidase_3 397 527 1.5e-7 PFAM
low complexity region 1013 1019 N/A INTRINSIC
low complexity region 1045 1058 N/A INTRINSIC
low complexity region 1156 1173 N/A INTRINSIC
low complexity region 1352 1366 N/A INTRINSIC
low complexity region 1368 1382 N/A INTRINSIC
low complexity region 1440 1464 N/A INTRINSIC
Pfam:Cu-oxidase_3 1600 1714 9.1e-8 PFAM
FA58C 1865 2020 8.03e-36 SMART
FA58C 2024 2180 1.96e-30 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a glycoprotein coagulation factor that plays a critical role in the process of blood coagulation and hemostasis. The encoded protein is activated by thrombin, to generate a heterodimer containing heavy and light chains held together by calcium ions. About half of the mice lacking the encoded protein die at an embryonic stage possible due to abnormal yolk-sac vasculature while the remaining animals succumbed to massive hemorrhage immediately after birth. A point mutation in this gene has been shown to cause disseminated intravascular thrombosis in the perinatal period, resulting in frequent deaths of newborn mice. [provided by RefSeq, Apr 2015]
PHENOTYPE: Half of mice homozygous for a null allele die at E9-E10 with defects in yolk-sac vasculature and somite formation; the remaining half develop to term but die of massive hemorrhage within hours of birth. Mice homozygous for a knock-in (F5 Leiden) allele develop strain-specific perinatal thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T C 17: 56,883,358 F352L probably damaging Het
Acta2 T C 19: 34,244,983 D246G probably damaging Het
Ank2 A G 3: 127,096,839 probably benign Het
Bmpr2 T A 1: 59,870,280 I971N probably damaging Het
C9 C A 15: 6,489,943 C8* probably null Het
Casp2 T A 6: 42,269,330 N207K probably damaging Het
Cd302 T G 2: 60,272,107 D56A probably benign Het
Cecr2 C T 6: 120,757,578 P605S probably damaging Het
Cep152 A G 2: 125,587,668 V723A probably damaging Het
Col17a1 C T 19: 47,650,721 probably null Het
Ctsk T C 3: 95,502,685 V168A probably damaging Het
Cyp2c54 A T 19: 40,071,560 N176K probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Hivep2 G A 10: 14,129,638 G660D probably benign Het
Hspb3 A T 13: 113,663,152 I114K probably damaging Het
Itgb7 T G 15: 102,216,160 *807C probably null Het
Kbtbd2 A G 6: 56,779,254 V499A probably damaging Het
Lemd3 A T 10: 120,933,660 I589N probably damaging Het
Mettl13 T C 1: 162,548,123 Y45C probably damaging Het
Mllt6 C T 11: 97,674,447 T571I probably damaging Het
Mrvi1 G A 7: 110,929,512 P43S probably damaging Het
Nabp1 A G 1: 51,474,540 I99T probably damaging Het
Ndufa4 A G 6: 11,906,053 V33A probably benign Het
Nr1h5 A G 3: 102,949,597 S200P probably damaging Het
Ntsr1 G A 2: 180,542,683 R393H probably benign Het
Olfr115 T C 17: 37,610,155 N199D probably benign Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Pcdhb21 A T 18: 37,514,683 K288N probably benign Het
Pla2g6 T C 15: 79,306,310 N351D probably benign Het
Polg T C 7: 79,459,836 E411G probably damaging Het
Ppp1r32 A T 19: 10,477,089 Y328N probably damaging Het
Prdm11 A G 2: 93,013,792 L31P probably damaging Het
Rab27b G A 18: 69,996,103 T40I probably damaging Het
Rnf219 C T 14: 104,503,414 E191K probably damaging Het
Ruvbl2 T C 7: 45,428,758 D97G probably benign Het
Sema3a T C 5: 13,599,275 V664A possibly damaging Het
Sh2d3c T C 2: 32,754,530 S842P probably damaging Het
Spam1 A G 6: 24,796,316 T89A probably damaging Het
Stab1 C T 14: 31,141,081 G2187E probably benign Het
Tff2 C A 17: 31,144,233 A6S probably benign Het
Trim80 T C 11: 115,448,174 V610A probably damaging Het
Trp53bp1 A G 2: 121,270,576 V47A possibly damaging Het
Ufl1 G A 4: 25,267,796 Q292* probably null Het
Ulk1 A T 5: 110,790,393 V571E possibly damaging Het
Usp24 A T 4: 106,360,420 N447Y probably damaging Het
Vmn1r81 A T 7: 12,259,847 I278K probably damaging Het
Other mutations in F5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:F5 APN 1 164179524 missense probably benign 0.15
IGL00843:F5 APN 1 164211791 missense probably benign 0.00
IGL00904:F5 APN 1 164194009 missense probably benign
IGL00913:F5 APN 1 164204896 missense probably damaging 1.00
IGL01099:F5 APN 1 164194334 missense probably damaging 0.99
IGL01134:F5 APN 1 164191979 missense possibly damaging 0.87
IGL01313:F5 APN 1 164193612 missense probably benign 0.01
IGL01635:F5 APN 1 164207858 missense probably benign 0.00
IGL01697:F5 APN 1 164194052 missense probably benign 0.04
IGL01768:F5 APN 1 164176345 missense probably benign 0.22
IGL01795:F5 APN 1 164194390 missense probably benign 0.00
IGL01835:F5 APN 1 164194368 missense probably benign 0.12
IGL01843:F5 APN 1 164211826 missense probably benign 0.05
IGL01989:F5 APN 1 164176307 missense probably benign 0.39
IGL02036:F5 APN 1 164183002 splice site probably benign
IGL02065:F5 APN 1 164190126 missense probably damaging 1.00
IGL02077:F5 APN 1 164198866 missense probably damaging 1.00
IGL02139:F5 APN 1 164192674 missense possibly damaging 0.89
IGL02210:F5 APN 1 164190141 missense probably benign 0.00
IGL02415:F5 APN 1 164191929 missense probably damaging 1.00
IGL02440:F5 APN 1 164207066 missense possibly damaging 0.79
IGL02471:F5 APN 1 164174291 missense probably damaging 1.00
IGL02535:F5 APN 1 164198733 missense probably damaging 0.98
IGL02537:F5 APN 1 164193117 missense probably benign 0.26
IGL02628:F5 APN 1 164194075 missense probably damaging 0.99
IGL02638:F5 APN 1 164184608 critical splice donor site probably null
IGL02824:F5 APN 1 164194347 missense probably benign 0.00
IGL02977:F5 APN 1 164194021 missense probably damaging 1.00
IGL03028:F5 APN 1 164193000 nonsense probably null
IGL03064:F5 APN 1 164195594 missense probably benign 0.04
IGL03127:F5 APN 1 164193538 missense probably benign 0.45
IGL03131:F5 APN 1 164161819 missense possibly damaging 0.62
IGL03348:F5 APN 1 164194152 missense possibly damaging 0.49
IGL03387:F5 APN 1 164193232 missense probably damaging 1.00
James_dean UTSW 1 164204820 missense probably benign 0.43
R0002:F5 UTSW 1 164201631 missense probably damaging 1.00
R0095:F5 UTSW 1 164191968 nonsense probably null
R0116:F5 UTSW 1 164184914 missense probably benign 0.01
R0359:F5 UTSW 1 164179449 missense probably damaging 1.00
R0426:F5 UTSW 1 164182840 missense probably damaging 0.99
R0452:F5 UTSW 1 164185107 missense probably damaging 0.99
R0457:F5 UTSW 1 164194200 missense probably benign 0.00
R0520:F5 UTSW 1 164209587 missense probably benign 0.15
R0522:F5 UTSW 1 164211763 missense probably damaging 1.00
R0554:F5 UTSW 1 164179449 missense probably damaging 1.00
R0575:F5 UTSW 1 164176244 missense probably damaging 1.00
R0734:F5 UTSW 1 164198917 missense probably damaging 1.00
R0739:F5 UTSW 1 164198917 missense probably damaging 1.00
R1062:F5 UTSW 1 164198917 missense probably damaging 1.00
R1063:F5 UTSW 1 164198917 missense probably damaging 1.00
R1149:F5 UTSW 1 164198917 missense probably damaging 1.00
R1149:F5 UTSW 1 164198917 missense probably damaging 1.00
R1150:F5 UTSW 1 164198917 missense probably damaging 1.00
R1151:F5 UTSW 1 164198917 missense probably damaging 1.00
R1152:F5 UTSW 1 164198917 missense probably damaging 1.00
R1221:F5 UTSW 1 164161799 missense probably damaging 1.00
R1284:F5 UTSW 1 164198917 missense probably damaging 1.00
R1286:F5 UTSW 1 164198917 missense probably damaging 1.00
R1358:F5 UTSW 1 164198917 missense probably damaging 1.00
R1360:F5 UTSW 1 164198917 missense probably damaging 1.00
R1362:F5 UTSW 1 164198917 missense probably damaging 1.00
R1383:F5 UTSW 1 164198917 missense probably damaging 1.00
R1465:F5 UTSW 1 164198833 missense probably benign 0.02
R1465:F5 UTSW 1 164198833 missense probably benign 0.02
R1545:F5 UTSW 1 164208960 nonsense probably null
R1561:F5 UTSW 1 164186903 nonsense probably null
R1623:F5 UTSW 1 164195622 missense probably damaging 1.00
R1662:F5 UTSW 1 164207888 missense probably damaging 1.00
R1673:F5 UTSW 1 164179520 missense probably damaging 1.00
R1689:F5 UTSW 1 164198917 missense probably damaging 1.00
R1705:F5 UTSW 1 164217490 missense possibly damaging 0.92
R1732:F5 UTSW 1 164174150 missense probably damaging 1.00
R1763:F5 UTSW 1 164192535 missense probably benign 0.04
R1774:F5 UTSW 1 164192535 missense probably benign 0.04
R1799:F5 UTSW 1 164193531 missense possibly damaging 0.58
R1800:F5 UTSW 1 164182834 missense probably damaging 1.00
R1842:F5 UTSW 1 164184560 missense probably damaging 0.99
R1915:F5 UTSW 1 164182917 missense probably damaging 0.97
R1926:F5 UTSW 1 164179508 missense probably damaging 1.00
R2025:F5 UTSW 1 164209475 missense probably benign 0.05
R2198:F5 UTSW 1 164207034 missense probably damaging 1.00
R2258:F5 UTSW 1 164192181 missense probably damaging 1.00
R2264:F5 UTSW 1 164194402 missense probably benign 0.32
R2281:F5 UTSW 1 164195720 missense possibly damaging 0.80
R2407:F5 UTSW 1 164211872 missense probably damaging 1.00
R2445:F5 UTSW 1 164190226 missense probably damaging 1.00
R2860:F5 UTSW 1 164184964 missense probably damaging 1.00
R2861:F5 UTSW 1 164184964 missense probably damaging 1.00
R2862:F5 UTSW 1 164184964 missense probably damaging 1.00
R2899:F5 UTSW 1 164186900 missense possibly damaging 0.88
R2910:F5 UTSW 1 164204820 missense probably benign 0.43
R2912:F5 UTSW 1 164193919 missense probably damaging 0.98
R2996:F5 UTSW 1 164182917 missense probably damaging 0.97
R3745:F5 UTSW 1 164186779 missense possibly damaging 0.79
R3901:F5 UTSW 1 164176229 missense probably benign 0.08
R3902:F5 UTSW 1 164176229 missense probably benign 0.08
R4365:F5 UTSW 1 164184950 missense probably damaging 0.98
R4448:F5 UTSW 1 164198899 missense possibly damaging 0.52
R4490:F5 UTSW 1 164217395 missense probably benign 0.40
R4514:F5 UTSW 1 164151997 unclassified probably benign
R4598:F5 UTSW 1 164204797 missense probably benign 0.05
R4608:F5 UTSW 1 164209029 missense probably benign 0.12
R4661:F5 UTSW 1 164184920 missense probably damaging 1.00
R4667:F5 UTSW 1 164174186 missense probably benign 0.00
R4689:F5 UTSW 1 164151973 unclassified probably benign
R4716:F5 UTSW 1 164193919 missense probably damaging 0.98
R4732:F5 UTSW 1 164181657 missense probably damaging 1.00
R4733:F5 UTSW 1 164181657 missense probably damaging 1.00
R4854:F5 UTSW 1 164192146 missense probably damaging 1.00
R4908:F5 UTSW 1 164211820 missense probably damaging 1.00
R4971:F5 UTSW 1 164194186 missense probably benign
R5001:F5 UTSW 1 164195570 missense probably benign 0.00
R5042:F5 UTSW 1 164219451 missense probably damaging 1.00
R5056:F5 UTSW 1 164192032 missense possibly damaging 0.60
R5061:F5 UTSW 1 164194180 missense probably benign 0.00
R5143:F5 UTSW 1 164211828 missense probably damaging 0.98
R5622:F5 UTSW 1 164192565 missense probably benign 0.09
R5626:F5 UTSW 1 164209035 missense probably damaging 0.98
R5658:F5 UTSW 1 164192338 missense probably damaging 0.96
R5702:F5 UTSW 1 164194547 nonsense probably null
R5795:F5 UTSW 1 164152009 missense probably benign 0.09
R5884:F5 UTSW 1 164195646 missense probably benign 0.01
R6036:F5 UTSW 1 164184996 missense probably damaging 0.99
R6036:F5 UTSW 1 164184996 missense probably damaging 0.99
R6151:F5 UTSW 1 164181635 missense probably damaging 1.00
R6151:F5 UTSW 1 164190187 missense probably damaging 1.00
R6345:F5 UTSW 1 164191951 missense probably benign 0.13
R6391:F5 UTSW 1 164193493 missense probably damaging 0.99
R6542:F5 UTSW 1 164194468 missense probably benign 0.32
R6620:F5 UTSW 1 164186806 missense probably damaging 1.00
R6750:F5 UTSW 1 164193507 missense possibly damaging 0.58
R6774:F5 UTSW 1 164186878 missense probably damaging 1.00
R6802:F5 UTSW 1 164179356 missense probably damaging 0.98
R6810:F5 UTSW 1 164186902 missense probably damaging 1.00
R6983:F5 UTSW 1 164194129 missense probably damaging 1.00
R7000:F5 UTSW 1 164179506 missense probably damaging 1.00
R7151:F5 UTSW 1 164201661 missense probably damaging 1.00
R7193:F5 UTSW 1 164219397 missense probably damaging 1.00
R7230:F5 UTSW 1 164184953 missense probably benign
X0024:F5 UTSW 1 164192988 missense probably damaging 1.00
Z1088:F5 UTSW 1 164154385 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAGACCTGGATCAGTTGCTC -3'
(R):5'- TGAGGAGAGAGGTACCTGACTC -3'

Sequencing Primer
(F):5'- TGCTCCTTTCTCCAGAAGACAATCAG -3'
(R):5'- CCTGACTCAGGTCTAGGAAGTAATTC -3'
Posted On2018-08-01