Incidental Mutation 'R6754:Ulk1'
ID530952
Institutional Source Beutler Lab
Gene Symbol Ulk1
Ensembl Gene ENSMUSG00000029512
Gene Nameunc-51 like kinase 1
SynonymsUnc51.1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6754 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location110784488-110810097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110790393 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 571 (V571E)
Ref Sequence ENSEMBL: ENSMUSP00000143536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031490] [ENSMUST00000196094] [ENSMUST00000198561] [ENSMUST00000200299]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031490
AA Change: V565E

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031490
Gene: ENSMUSG00000029512
AA Change: V565E

DomainStartEndE-ValueType
S_TKc 16 278 3.6e-98 SMART
low complexity region 287 318 N/A INTRINSIC
low complexity region 340 356 N/A INTRINSIC
low complexity region 400 423 N/A INTRINSIC
Blast:S_TKc 459 837 1e-131 BLAST
Pfam:DUF3543 838 1048 1.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196440
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198470
Predicted Effect probably benign
Transcript: ENSMUST00000198561
SMART Domains Protein: ENSMUSP00000143308
Gene: ENSMUSG00000029512

DomainStartEndE-ValueType
Blast:S_TKc 1 75 5e-24 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200099
Predicted Effect possibly damaging
Transcript: ENSMUST00000200299
AA Change: V571E

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143536
Gene: ENSMUSG00000029512
AA Change: V571E

DomainStartEndE-ValueType
S_TKc 16 278 7.47e-96 SMART
low complexity region 287 318 N/A INTRINSIC
low complexity region 340 356 N/A INTRINSIC
low complexity region 400 423 N/A INTRINSIC
Blast:S_TKc 459 843 1e-129 BLAST
Pfam:DUF3543 844 1054 1.4e-29 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Null homozygotes have blood defects including an increase in mean corpuscular volume and the presence of red blood cells that contain mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T C 17: 56,883,358 F352L probably damaging Het
Acta2 T C 19: 34,244,983 D246G probably damaging Het
Ank2 A G 3: 127,096,839 probably benign Het
Bmpr2 T A 1: 59,870,280 I971N probably damaging Het
C9 C A 15: 6,489,943 C8* probably null Het
Casp2 T A 6: 42,269,330 N207K probably damaging Het
Cd302 T G 2: 60,272,107 D56A probably benign Het
Cecr2 C T 6: 120,757,578 P605S probably damaging Het
Cep152 A G 2: 125,587,668 V723A probably damaging Het
Col17a1 C T 19: 47,650,721 probably null Het
Ctsk T C 3: 95,502,685 V168A probably damaging Het
Cyp2c54 A T 19: 40,071,560 N176K probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
F5 A G 1: 164,193,763 D1269G probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Hivep2 G A 10: 14,129,638 G660D probably benign Het
Hspb3 A T 13: 113,663,152 I114K probably damaging Het
Itgb7 T G 15: 102,216,160 *807C probably null Het
Kbtbd2 A G 6: 56,779,254 V499A probably damaging Het
Lemd3 A T 10: 120,933,660 I589N probably damaging Het
Mettl13 T C 1: 162,548,123 Y45C probably damaging Het
Mllt6 C T 11: 97,674,447 T571I probably damaging Het
Mrvi1 G A 7: 110,929,512 P43S probably damaging Het
Nabp1 A G 1: 51,474,540 I99T probably damaging Het
Ndufa4 A G 6: 11,906,053 V33A probably benign Het
Nr1h5 A G 3: 102,949,597 S200P probably damaging Het
Ntsr1 G A 2: 180,542,683 R393H probably benign Het
Olfr115 T C 17: 37,610,155 N199D probably benign Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Pcdhb21 A T 18: 37,514,683 K288N probably benign Het
Pla2g6 T C 15: 79,306,310 N351D probably benign Het
Polg T C 7: 79,459,836 E411G probably damaging Het
Ppp1r32 A T 19: 10,477,089 Y328N probably damaging Het
Prdm11 A G 2: 93,013,792 L31P probably damaging Het
Rab27b G A 18: 69,996,103 T40I probably damaging Het
Rnf219 C T 14: 104,503,414 E191K probably damaging Het
Ruvbl2 T C 7: 45,428,758 D97G probably benign Het
Sema3a T C 5: 13,599,275 V664A possibly damaging Het
Sh2d3c T C 2: 32,754,530 S842P probably damaging Het
Spam1 A G 6: 24,796,316 T89A probably damaging Het
Stab1 C T 14: 31,141,081 G2187E probably benign Het
Tff2 C A 17: 31,144,233 A6S probably benign Het
Trim80 T C 11: 115,448,174 V610A probably damaging Het
Trp53bp1 A G 2: 121,270,576 V47A possibly damaging Het
Ufl1 G A 4: 25,267,796 Q292* probably null Het
Usp24 A T 4: 106,360,420 N447Y probably damaging Het
Vmn1r81 A T 7: 12,259,847 I278K probably damaging Het
Other mutations in Ulk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Ulk1 APN 5 110787872 missense probably damaging 1.00
IGL00916:Ulk1 APN 5 110793011 missense probably damaging 1.00
IGL00951:Ulk1 APN 5 110792404 missense possibly damaging 0.85
IGL02404:Ulk1 APN 5 110796234 splice site probably null
IGL02415:Ulk1 APN 5 110787621 missense probably damaging 1.00
IGL02500:Ulk1 APN 5 110809134 missense probably damaging 1.00
IGL02696:Ulk1 APN 5 110793052 missense probably damaging 1.00
R0086:Ulk1 UTSW 5 110787707 splice site probably benign
R0092:Ulk1 UTSW 5 110796327 missense probably null 1.00
R0158:Ulk1 UTSW 5 110788944 splice site probably benign
R0387:Ulk1 UTSW 5 110788797 missense possibly damaging 0.91
R0453:Ulk1 UTSW 5 110791085 missense probably damaging 1.00
R0837:Ulk1 UTSW 5 110789545 splice site probably benign
R1244:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R1245:Ulk1 UTSW 5 110789340 critical splice donor site probably null
R1268:Ulk1 UTSW 5 110790277 missense probably damaging 1.00
R1342:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R1586:Ulk1 UTSW 5 110789516 missense probably damaging 1.00
R1590:Ulk1 UTSW 5 110795766 missense probably damaging 1.00
R1816:Ulk1 UTSW 5 110787831 missense probably damaging 1.00
R1837:Ulk1 UTSW 5 110789381 missense probably damaging 1.00
R1924:Ulk1 UTSW 5 110791070 missense probably damaging 0.97
R1992:Ulk1 UTSW 5 110787151 missense probably damaging 1.00
R2126:Ulk1 UTSW 5 110792436 missense probably benign 0.27
R2276:Ulk1 UTSW 5 110788162 missense probably benign 0.00
R2310:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2311:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2312:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2760:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2762:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2763:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2764:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2859:Ulk1 UTSW 5 110794629 missense probably damaging 1.00
R2932:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R3760:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R3761:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R3762:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R3763:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R4334:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R4419:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R4471:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R4615:Ulk1 UTSW 5 110789046 missense probably damaging 1.00
R4776:Ulk1 UTSW 5 110788947 critical splice donor site probably null
R4820:Ulk1 UTSW 5 110792130 missense probably benign
R4912:Ulk1 UTSW 5 110787589 missense probably damaging 1.00
R6299:Ulk1 UTSW 5 110791097 missense possibly damaging 0.78
R7233:Ulk1 UTSW 5 110809042 missense probably damaging 1.00
X0025:Ulk1 UTSW 5 110792129 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGATCCTTTCCCACCCCATAGG -3'
(R):5'- AATGATTGTCACAGAGGCCTTG -3'

Sequencing Primer
(F):5'- CTCCTAGAAGCTGTTACCTTGGTAG -3'
(R):5'- CACAGAGGCCTTGGTTGG -3'
Posted On2018-08-01