Incidental Mutation 'R6754:Trim80'
ID530966
Institutional Source Beutler Lab
Gene Symbol Trim80
Ensembl Gene ENSMUSG00000070332
Gene Nametripartite motif-containing 80
Synonyms4933422H20Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6754 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location115440545-115448270 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115448174 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 610 (V610A)
Ref Sequence ENSEMBL: ENSMUSP00000091442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093914]
Predicted Effect probably damaging
Transcript: ENSMUST00000093914
AA Change: V610A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091442
Gene: ENSMUSG00000070332
AA Change: V610A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
RING 71 114 4.48e-7 SMART
Blast:BBOX 154 202 7e-22 BLAST
Pfam:zf-B_box 207 246 2.2e-10 PFAM
Blast:PRY 441 496 2e-18 BLAST
Pfam:SPRY 499 621 3.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175355
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T C 17: 56,883,358 F352L probably damaging Het
Acta2 T C 19: 34,244,983 D246G probably damaging Het
Ank2 A G 3: 127,096,839 probably benign Het
Bmpr2 T A 1: 59,870,280 I971N probably damaging Het
C9 C A 15: 6,489,943 C8* probably null Het
Casp2 T A 6: 42,269,330 N207K probably damaging Het
Cd302 T G 2: 60,272,107 D56A probably benign Het
Cecr2 C T 6: 120,757,578 P605S probably damaging Het
Cep152 A G 2: 125,587,668 V723A probably damaging Het
Col17a1 C T 19: 47,650,721 probably null Het
Ctsk T C 3: 95,502,685 V168A probably damaging Het
Cyp2c54 A T 19: 40,071,560 N176K probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
F5 A G 1: 164,193,763 D1269G probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Hivep2 G A 10: 14,129,638 G660D probably benign Het
Hspb3 A T 13: 113,663,152 I114K probably damaging Het
Itgb7 T G 15: 102,216,160 *807C probably null Het
Kbtbd2 A G 6: 56,779,254 V499A probably damaging Het
Lemd3 A T 10: 120,933,660 I589N probably damaging Het
Mettl13 T C 1: 162,548,123 Y45C probably damaging Het
Mllt6 C T 11: 97,674,447 T571I probably damaging Het
Mrvi1 G A 7: 110,929,512 P43S probably damaging Het
Nabp1 A G 1: 51,474,540 I99T probably damaging Het
Ndufa4 A G 6: 11,906,053 V33A probably benign Het
Nr1h5 A G 3: 102,949,597 S200P probably damaging Het
Ntsr1 G A 2: 180,542,683 R393H probably benign Het
Olfr115 T C 17: 37,610,155 N199D probably benign Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Pcdhb21 A T 18: 37,514,683 K288N probably benign Het
Pla2g6 T C 15: 79,306,310 N351D probably benign Het
Polg T C 7: 79,459,836 E411G probably damaging Het
Ppp1r32 A T 19: 10,477,089 Y328N probably damaging Het
Prdm11 A G 2: 93,013,792 L31P probably damaging Het
Rab27b G A 18: 69,996,103 T40I probably damaging Het
Rnf219 C T 14: 104,503,414 E191K probably damaging Het
Ruvbl2 T C 7: 45,428,758 D97G probably benign Het
Sema3a T C 5: 13,599,275 V664A possibly damaging Het
Sh2d3c T C 2: 32,754,530 S842P probably damaging Het
Spam1 A G 6: 24,796,316 T89A probably damaging Het
Stab1 C T 14: 31,141,081 G2187E probably benign Het
Tff2 C A 17: 31,144,233 A6S probably benign Het
Trp53bp1 A G 2: 121,270,576 V47A possibly damaging Het
Ufl1 G A 4: 25,267,796 Q292* probably null Het
Ulk1 A T 5: 110,790,393 V571E possibly damaging Het
Usp24 A T 4: 106,360,420 N447Y probably damaging Het
Vmn1r81 A T 7: 12,259,847 I278K probably damaging Het
Other mutations in Trim80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Trim80 APN 11 115447665 missense probably benign 0.21
IGL00921:Trim80 APN 11 115447664 missense probably benign 0.00
IGL02948:Trim80 APN 11 115441593 missense possibly damaging 0.81
IGL03037:Trim80 APN 11 115441593 missense possibly damaging 0.81
R0019:Trim80 UTSW 11 115447942 missense probably damaging 1.00
R0019:Trim80 UTSW 11 115447942 missense probably damaging 1.00
R0409:Trim80 UTSW 11 115441213 missense probably damaging 1.00
R1069:Trim80 UTSW 11 115448083 missense probably damaging 1.00
R1832:Trim80 UTSW 11 115446793 missense probably benign
R1952:Trim80 UTSW 11 115441329 nonsense probably null
R2892:Trim80 UTSW 11 115448023 missense possibly damaging 0.81
R4301:Trim80 UTSW 11 115445113 critical splice donor site probably null
R4748:Trim80 UTSW 11 115448138 missense possibly damaging 0.84
R4795:Trim80 UTSW 11 115447943 missense probably damaging 1.00
R4819:Trim80 UTSW 11 115447943 missense probably damaging 1.00
R4910:Trim80 UTSW 11 115446455 missense probably damaging 0.99
R5245:Trim80 UTSW 11 115441572 missense probably damaging 1.00
R5288:Trim80 UTSW 11 115448017 missense probably benign 0.07
R5384:Trim80 UTSW 11 115448017 missense probably benign 0.07
R5386:Trim80 UTSW 11 115448017 missense probably benign 0.07
R5508:Trim80 UTSW 11 115445078 missense probably benign 0.06
R5645:Trim80 UTSW 11 115446785 missense probably damaging 1.00
R5785:Trim80 UTSW 11 115446475 nonsense probably null
R5822:Trim80 UTSW 11 115447921 missense probably damaging 0.99
R6785:Trim80 UTSW 11 115441201 missense probably damaging 0.99
R6788:Trim80 UTSW 11 115448017 missense probably benign 0.07
R7336:Trim80 UTSW 11 115441216 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTACTCATGGTGTCTGGAGTG -3'
(R):5'- TTCTGCCCTGGGAACAATG -3'

Sequencing Primer
(F):5'- AAGTTCTCTGTGTGGCACAAC -3'
(R):5'- TGGGAACAATGACCCTGGCAC -3'
Posted On2018-08-01