Incidental Mutation 'R6755:Tesk1'
ID530994
Institutional Source Beutler Lab
Gene Symbol Tesk1
Ensembl Gene ENSMUSG00000028458
Gene Nametestis specific protein kinase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock #R6755 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location43441939-43448064 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43445991 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 308 (Q308R)
Ref Sequence ENSEMBL: ENSMUSP00000050087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030179] [ENSMUST00000060864] [ENSMUST00000098104] [ENSMUST00000098105] [ENSMUST00000107925] [ENSMUST00000107926] [ENSMUST00000138981]
Predicted Effect probably benign
Transcript: ENSMUST00000030179
SMART Domains Protein: ENSMUSP00000030179
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
coiled coil region 137 223 N/A INTRINSIC
CLECT 232 348 2.28e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060864
AA Change: Q308R

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000050087
Gene: ENSMUSG00000028458
AA Change: Q308R

DomainStartEndE-ValueType
low complexity region 2 33 N/A INTRINSIC
Pfam:Pkinase 52 306 5.4e-46 PFAM
Pfam:Pkinase_Tyr 52 306 3.1e-47 PFAM
low complexity region 316 330 N/A INTRINSIC
low complexity region 345 370 N/A INTRINSIC
low complexity region 403 424 N/A INTRINSIC
low complexity region 472 490 N/A INTRINSIC
low complexity region 513 525 N/A INTRINSIC
low complexity region 549 565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098104
SMART Domains Protein: ENSMUSP00000095708
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
coiled coil region 83 169 N/A INTRINSIC
CLECT 178 287 2.48e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098105
SMART Domains Protein: ENSMUSP00000095709
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
transmembrane domain 72 94 N/A INTRINSIC
coiled coil region 113 199 N/A INTRINSIC
CLECT 208 324 2.28e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107925
SMART Domains Protein: ENSMUSP00000103558
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
coiled coil region 137 223 N/A INTRINSIC
CLECT 232 334 2.65e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107926
SMART Domains Protein: ENSMUSP00000103559
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
coiled coil region 137 223 N/A INTRINSIC
CLECT 232 341 2.48e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137178
Predicted Effect probably benign
Transcript: ENSMUST00000138981
SMART Domains Protein: ENSMUSP00000121067
Gene: ENSMUSG00000028458

DomainStartEndE-ValueType
low complexity region 2 33 N/A INTRINSIC
Pfam:Pkinase 52 174 7.6e-29 PFAM
Pfam:Pkinase_Tyr 52 175 1.5e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156810
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a serine/threonine protein kinase that contains an N-terminal protein kinase domain and a C-terminal proline-rich domain. Its protein kinase domain is most closely related to those of the LIM motif-containing protein kinases (LIMKs). The encoded protein can phosphorylate myelin basic protein and histone in vitro. The testicular germ cell-specific expression and developmental pattern of expression of the mouse gene suggests that this gene plays an important role at and after the meiotic phase of spermatogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,164,972 T364A probably benign Het
2210408I21Rik C T 13: 77,327,875 T1101M probably benign Het
4930433I11Rik T C 7: 40,994,310 S468P probably damaging Het
AA792892 A G 5: 94,381,409 T13A probably benign Het
Adam33 A G 2: 131,053,149 V637A probably damaging Het
Adcy5 G A 16: 35,303,634 V1228M possibly damaging Het
Ahi1 G T 10: 21,017,913 V848F probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
B4galt6 T C 18: 20,689,329 E264G probably benign Het
Bpifb4 A G 2: 153,957,738 T556A probably damaging Het
Bptf A T 11: 107,047,256 S64T probably benign Het
C3ar1 A G 6: 122,849,858 S467P probably benign Het
Cables1 G T 18: 11,939,825 S479I probably null Het
Cbl T C 9: 44,173,374 I155V probably damaging Het
Cdh16 T C 8: 104,619,248 D297G probably damaging Het
Cdk8 T A 5: 146,268,316 H102Q probably damaging Het
Cpn2 A T 16: 30,260,331 L184Q probably damaging Het
Ctso T A 3: 81,942,302 H109Q probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drc1 A G 5: 30,355,146 E299G probably damaging Het
Elp6 A G 9: 110,315,825 E150G possibly damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fbn2 A G 18: 58,113,333 L499S possibly damaging Het
Fgf10 C A 13: 118,789,285 A200D probably damaging Het
Fhad1 T C 4: 141,964,604 E407G probably damaging Het
Hif1an T C 19: 44,568,452 V232A probably damaging Het
Ift172 T A 5: 31,260,998 K1214* probably null Het
Il20ra T C 10: 19,750,794 Y189H probably benign Het
Isg20l2 T A 3: 87,931,689 I69N probably benign Het
Kdelc1 C T 1: 44,110,734 probably null Het
Kif11 A G 19: 37,409,751 D675G probably benign Het
Klhdc7a T A 4: 139,966,475 D387V possibly damaging Het
Lrrc4 T C 6: 28,831,293 N108D probably damaging Het
Ltbp2 T A 12: 84,795,073 E944V probably damaging Het
Magi1 C T 6: 93,708,177 S740N probably damaging Het
Med26 A G 8: 72,495,833 I474T probably damaging Het
Mgst1 T A 6: 138,147,772 M68K probably damaging Het
Myh7 G A 14: 54,992,313 A91V possibly damaging Het
Nhlrc2 G A 19: 56,591,784 V450I probably benign Het
Nup160 T G 2: 90,700,456 F486C probably damaging Het
Obscn A T 11: 59,103,326 Y1602N probably damaging Het
Olfr629 T A 7: 103,740,500 T247S probably damaging Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otogl A T 10: 107,853,303 Y955* probably null Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pianp T C 6: 124,999,384 V52A probably benign Het
Plekhh2 T C 17: 84,591,585 Y997H probably damaging Het
Plekhm1 G T 11: 103,387,243 S342R possibly damaging Het
Ppp4r4 T A 12: 103,585,737 V81E probably damaging Het
Ptafr A G 4: 132,579,346 T16A probably benign Het
Ptpn23 A T 9: 110,389,787 L445Q probably damaging Het
Rasa1 A T 13: 85,226,598 F751L possibly damaging Het
Sap18 A C 14: 57,802,017 D153A probably damaging Het
Slc38a11 C T 2: 65,363,891 G10D probably benign Het
Snx32 T C 19: 5,510,344 N10D probably benign Het
Sox6 T C 7: 115,662,442 T180A probably damaging Het
Srrt T C 5: 137,302,930 K78R probably damaging Het
Syce3 T C 15: 89,397,364 D24G probably damaging Het
Taok3 T A 5: 117,206,667 I153N probably damaging Het
Tm7sf3 A T 6: 146,609,973 probably null Het
Tmbim6 T C 15: 99,402,153 V50A probably benign Het
Tmem107 T C 11: 69,071,011 V22A probably damaging Het
Ttc12 T C 9: 49,453,346 I377V probably benign Het
Ufl1 T A 4: 25,262,316 N310I probably damaging Het
Ush2a C A 1: 188,443,219 N1171K possibly damaging Het
Utrn A T 10: 12,699,087 V1032E probably benign Het
Other mutations in Tesk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01755:Tesk1 APN 4 43445820 critical splice donor site probably null
IGL02969:Tesk1 APN 4 43447027 missense possibly damaging 0.49
IGL02969:Tesk1 APN 4 43447026 nonsense probably null
FR4449:Tesk1 UTSW 4 43447002 utr 3 prime probably benign
FR4737:Tesk1 UTSW 4 43447004 frame shift probably null
R0009:Tesk1 UTSW 4 43445368 missense probably damaging 0.99
R0396:Tesk1 UTSW 4 43446000 missense probably damaging 0.99
R0765:Tesk1 UTSW 4 43446706 missense possibly damaging 0.81
R1850:Tesk1 UTSW 4 43443576 missense probably damaging 1.00
R1868:Tesk1 UTSW 4 43447201 missense probably damaging 0.99
R1903:Tesk1 UTSW 4 43446998 missense probably benign 0.00
R3961:Tesk1 UTSW 4 43445133 splice site probably null
R3973:Tesk1 UTSW 4 43445786 missense possibly damaging 0.50
R3975:Tesk1 UTSW 4 43445786 missense possibly damaging 0.50
R3976:Tesk1 UTSW 4 43445786 missense possibly damaging 0.50
R4074:Tesk1 UTSW 4 43443606 missense possibly damaging 0.88
R4908:Tesk1 UTSW 4 43445555 nonsense probably null
R5002:Tesk1 UTSW 4 43444573 missense probably damaging 1.00
R5237:Tesk1 UTSW 4 43447100 missense probably damaging 0.98
R6886:Tesk1 UTSW 4 43443592 missense possibly damaging 0.72
R6991:Tesk1 UTSW 4 43447006 missense probably benign
R6992:Tesk1 UTSW 4 43447006 missense probably benign
R6993:Tesk1 UTSW 4 43447006 missense probably benign
X0064:Tesk1 UTSW 4 43443534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCACTGCTGCAGCGTAAG -3'
(R):5'- ACCATCTTCTGTGAGATGCCTC -3'

Sequencing Primer
(F):5'- TGCTGCAGCGTAAGTGTCAC -3'
(R):5'- GTGAGATGCCTCTCCATCCCAC -3'
Posted On2018-08-01