Incidental Mutation 'R6755:Pianp'
ID531008
Institutional Source Beutler Lab
Gene Symbol Pianp
Ensembl Gene ENSMUSG00000030329
Gene NamePILR alpha associated neural protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6755 (G1)
Quality Score204.009
Status Not validated
Chromosome6
Chromosomal Location124996694-125003096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124999384 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 52 (V52A)
Ref Sequence ENSEMBL: ENSMUSP00000123940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032479] [ENSMUST00000159391] [ENSMUST00000160666] [ENSMUST00000160704] [ENSMUST00000161292] [ENSMUST00000162000] [ENSMUST00000162170]
Predicted Effect probably benign
Transcript: ENSMUST00000032479
AA Change: V52A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000032479
Gene: ENSMUSG00000030329
AA Change: V52A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
Pfam:AJAP1_PANP_C 100 272 2.1e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159391
AA Change: V52A

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124024
Gene: ENSMUSG00000030329
AA Change: V52A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
Pfam:AJAP1_PANP_C 100 165 5.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160666
SMART Domains Protein: ENSMUSP00000125328
Gene: ENSMUSG00000030329

DomainStartEndE-ValueType
Pfam:AJAP1_PANP_C 4 63 5.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160704
AA Change: V52A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124160
Gene: ENSMUSG00000030329
AA Change: V52A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
Pfam:AJAP1_PANP_C 100 272 2.1e-61 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000161292
AA Change: V52A
SMART Domains Protein: ENSMUSP00000125600
Gene: ENSMUSG00000030329
AA Change: V52A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162000
AA Change: V52A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000145297
Gene: ENSMUSG00000030329
AA Change: V52A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
Pfam:AJAP1_PANP_C 130 240 3.3e-8 PFAM
low complexity region 251 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162170
AA Change: V52A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123940
Gene: ENSMUSG00000030329
AA Change: V52A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
Pfam:AJAP1_PANP_C 131 240 6.5e-12 PFAM
low complexity region 251 264 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ligand for the paired immunoglobin-like type 2 receptor alpha, and so may be involved in immune regulation. Alternate splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,164,972 T364A probably benign Het
2210408I21Rik C T 13: 77,327,875 T1101M probably benign Het
4930433I11Rik T C 7: 40,994,310 S468P probably damaging Het
AA792892 A G 5: 94,381,409 T13A probably benign Het
Adam33 A G 2: 131,053,149 V637A probably damaging Het
Adcy5 G A 16: 35,303,634 V1228M possibly damaging Het
Ahi1 G T 10: 21,017,913 V848F probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
B4galt6 T C 18: 20,689,329 E264G probably benign Het
Bpifb4 A G 2: 153,957,738 T556A probably damaging Het
Bptf A T 11: 107,047,256 S64T probably benign Het
C3ar1 A G 6: 122,849,858 S467P probably benign Het
Cables1 G T 18: 11,939,825 S479I probably null Het
Cbl T C 9: 44,173,374 I155V probably damaging Het
Cdh16 T C 8: 104,619,248 D297G probably damaging Het
Cdk8 T A 5: 146,268,316 H102Q probably damaging Het
Cpn2 A T 16: 30,260,331 L184Q probably damaging Het
Ctso T A 3: 81,942,302 H109Q probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drc1 A G 5: 30,355,146 E299G probably damaging Het
Elp6 A G 9: 110,315,825 E150G possibly damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fbn2 A G 18: 58,113,333 L499S possibly damaging Het
Fgf10 C A 13: 118,789,285 A200D probably damaging Het
Fhad1 T C 4: 141,964,604 E407G probably damaging Het
Hif1an T C 19: 44,568,452 V232A probably damaging Het
Ift172 T A 5: 31,260,998 K1214* probably null Het
Il20ra T C 10: 19,750,794 Y189H probably benign Het
Isg20l2 T A 3: 87,931,689 I69N probably benign Het
Kdelc1 C T 1: 44,110,734 probably null Het
Kif11 A G 19: 37,409,751 D675G probably benign Het
Klhdc7a T A 4: 139,966,475 D387V possibly damaging Het
Lrrc4 T C 6: 28,831,293 N108D probably damaging Het
Ltbp2 T A 12: 84,795,073 E944V probably damaging Het
Magi1 C T 6: 93,708,177 S740N probably damaging Het
Med26 A G 8: 72,495,833 I474T probably damaging Het
Mgst1 T A 6: 138,147,772 M68K probably damaging Het
Myh7 G A 14: 54,992,313 A91V possibly damaging Het
Nhlrc2 G A 19: 56,591,784 V450I probably benign Het
Nup160 T G 2: 90,700,456 F486C probably damaging Het
Obscn A T 11: 59,103,326 Y1602N probably damaging Het
Olfr629 T A 7: 103,740,500 T247S probably damaging Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otogl A T 10: 107,853,303 Y955* probably null Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Plekhh2 T C 17: 84,591,585 Y997H probably damaging Het
Plekhm1 G T 11: 103,387,243 S342R possibly damaging Het
Ppp4r4 T A 12: 103,585,737 V81E probably damaging Het
Ptafr A G 4: 132,579,346 T16A probably benign Het
Ptpn23 A T 9: 110,389,787 L445Q probably damaging Het
Rasa1 A T 13: 85,226,598 F751L possibly damaging Het
Sap18 A C 14: 57,802,017 D153A probably damaging Het
Slc38a11 C T 2: 65,363,891 G10D probably benign Het
Snx32 T C 19: 5,510,344 N10D probably benign Het
Sox6 T C 7: 115,662,442 T180A probably damaging Het
Srrt T C 5: 137,302,930 K78R probably damaging Het
Syce3 T C 15: 89,397,364 D24G probably damaging Het
Taok3 T A 5: 117,206,667 I153N probably damaging Het
Tesk1 A G 4: 43,445,991 Q308R probably benign Het
Tm7sf3 A T 6: 146,609,973 probably null Het
Tmbim6 T C 15: 99,402,153 V50A probably benign Het
Tmem107 T C 11: 69,071,011 V22A probably damaging Het
Ttc12 T C 9: 49,453,346 I377V probably benign Het
Ufl1 T A 4: 25,262,316 N310I probably damaging Het
Ush2a C A 1: 188,443,219 N1171K possibly damaging Het
Utrn A T 10: 12,699,087 V1032E probably benign Het
Other mutations in Pianp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01958:Pianp APN 6 125000683 missense possibly damaging 0.71
IGL02693:Pianp APN 6 125001635 missense possibly damaging 0.53
R0015:Pianp UTSW 6 125001540 missense probably damaging 1.00
R2208:Pianp UTSW 6 124999639 missense probably damaging 1.00
R6470:Pianp UTSW 6 124999269 unclassified probably benign
R6800:Pianp UTSW 6 125001602 missense possibly damaging 0.93
R6964:Pianp UTSW 6 124999390 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TCTACATGAGCCATCGCCTG -3'
(R):5'- ATCCAGGATTGACCGAGTTGG -3'

Sequencing Primer
(F):5'- ATCGCCTGGGTCTCACCTG -3'
(R):5'- AGTTGGGGTCCCCTCCATC -3'
Posted On2018-08-01