Incidental Mutation 'R6755:Myh7'
ID531034
Institutional Source Beutler Lab
Gene Symbol Myh7
Ensembl Gene ENSMUSG00000053093
Gene Namemyosin, heavy polypeptide 7, cardiac muscle, beta
SynonymsMyhcb, Myhc-b, MyHC-I, B-MHC, MYH-beta/slow, beta-MHC
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.812) question?
Stock #R6755 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location54970684-54994626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 54992313 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 91 (A91V)
Ref Sequence ENSEMBL: ENSMUSP00000126840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102803] [ENSMUST00000153783] [ENSMUST00000168485] [ENSMUST00000226424] [ENSMUST00000227518] [ENSMUST00000228837]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102803
AA Change: A91V

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099867
Gene: ENSMUSG00000053093
AA Change: A91V

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Myosin_N 34 73 3.8e-16 PFAM
MYSc 79 779 N/A SMART
IQ 780 802 2.5e-2 SMART
Pfam:Myosin_tail_1 843 1924 5.6e-168 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149852
Predicted Effect probably benign
Transcript: ENSMUST00000153783
SMART Domains Protein: ENSMUSP00000116595
Gene: ENSMUSG00000053093

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Myosin_N 34 61 8.8e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168485
AA Change: A91V

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126840
Gene: ENSMUSG00000053093
AA Change: A91V

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Myosin_N 34 75 1.6e-17 PFAM
MYSc 79 779 N/A SMART
IQ 780 802 2.5e-2 SMART
PDB:2FXO|D 838 963 6e-53 PDB
Pfam:Myosin_tail_1 1068 1926 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226424
Predicted Effect probably benign
Transcript: ENSMUST00000227518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228715
Predicted Effect possibly damaging
Transcript: ENSMUST00000228837
AA Change: A91V

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Muscle myosin is a hexameric protein containing 2 heavy chain subunits, 2 alkali light chain subunits, and 2 regulatory light chain subunits. This gene encodes the beta (or slow) heavy chain subunit of cardiac myosin. It is expressed predominantly in normal human ventricle. It is also expressed in skeletal muscle tissues rich in slow-twitch type I muscle fibers. Changes in the relative abundance of this protein and the alpha (or fast) heavy subunit of cardiac myosin correlate with the contractile velocity of cardiac muscle. Its expression is also altered during thyroid hormone depletion and hemodynamic overloading. Mutations in this gene are associated with familial hypertrophic cardiomyopathy, myosin storage myopathy, dilated cardiomyopathy, and Laing early-onset distal myopathy. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,164,972 T364A probably benign Het
2210408I21Rik C T 13: 77,327,875 T1101M probably benign Het
4930433I11Rik T C 7: 40,994,310 S468P probably damaging Het
AA792892 A G 5: 94,381,409 T13A probably benign Het
Adam33 A G 2: 131,053,149 V637A probably damaging Het
Adcy5 G A 16: 35,303,634 V1228M possibly damaging Het
Ahi1 G T 10: 21,017,913 V848F probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
B4galt6 T C 18: 20,689,329 E264G probably benign Het
Bpifb4 A G 2: 153,957,738 T556A probably damaging Het
Bptf A T 11: 107,047,256 S64T probably benign Het
C3ar1 A G 6: 122,849,858 S467P probably benign Het
Cables1 G T 18: 11,939,825 S479I probably null Het
Cbl T C 9: 44,173,374 I155V probably damaging Het
Cdh16 T C 8: 104,619,248 D297G probably damaging Het
Cdk8 T A 5: 146,268,316 H102Q probably damaging Het
Cpn2 A T 16: 30,260,331 L184Q probably damaging Het
Ctso T A 3: 81,942,302 H109Q probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drc1 A G 5: 30,355,146 E299G probably damaging Het
Elp6 A G 9: 110,315,825 E150G possibly damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fbn2 A G 18: 58,113,333 L499S possibly damaging Het
Fgf10 C A 13: 118,789,285 A200D probably damaging Het
Fhad1 T C 4: 141,964,604 E407G probably damaging Het
Hif1an T C 19: 44,568,452 V232A probably damaging Het
Ift172 T A 5: 31,260,998 K1214* probably null Het
Il20ra T C 10: 19,750,794 Y189H probably benign Het
Isg20l2 T A 3: 87,931,689 I69N probably benign Het
Kdelc1 C T 1: 44,110,734 probably null Het
Kif11 A G 19: 37,409,751 D675G probably benign Het
Klhdc7a T A 4: 139,966,475 D387V possibly damaging Het
Lrrc4 T C 6: 28,831,293 N108D probably damaging Het
Ltbp2 T A 12: 84,795,073 E944V probably damaging Het
Magi1 C T 6: 93,708,177 S740N probably damaging Het
Med26 A G 8: 72,495,833 I474T probably damaging Het
Mgst1 T A 6: 138,147,772 M68K probably damaging Het
Nhlrc2 G A 19: 56,591,784 V450I probably benign Het
Nup160 T G 2: 90,700,456 F486C probably damaging Het
Obscn A T 11: 59,103,326 Y1602N probably damaging Het
Olfr629 T A 7: 103,740,500 T247S probably damaging Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otogl A T 10: 107,853,303 Y955* probably null Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pianp T C 6: 124,999,384 V52A probably benign Het
Plekhh2 T C 17: 84,591,585 Y997H probably damaging Het
Plekhm1 G T 11: 103,387,243 S342R possibly damaging Het
Ppp4r4 T A 12: 103,585,737 V81E probably damaging Het
Ptafr A G 4: 132,579,346 T16A probably benign Het
Ptpn23 A T 9: 110,389,787 L445Q probably damaging Het
Rasa1 A T 13: 85,226,598 F751L possibly damaging Het
Sap18 A C 14: 57,802,017 D153A probably damaging Het
Slc38a11 C T 2: 65,363,891 G10D probably benign Het
Snx32 T C 19: 5,510,344 N10D probably benign Het
Sox6 T C 7: 115,662,442 T180A probably damaging Het
Srrt T C 5: 137,302,930 K78R probably damaging Het
Syce3 T C 15: 89,397,364 D24G probably damaging Het
Taok3 T A 5: 117,206,667 I153N probably damaging Het
Tesk1 A G 4: 43,445,991 Q308R probably benign Het
Tm7sf3 A T 6: 146,609,973 probably null Het
Tmbim6 T C 15: 99,402,153 V50A probably benign Het
Tmem107 T C 11: 69,071,011 V22A probably damaging Het
Ttc12 T C 9: 49,453,346 I377V probably benign Het
Ufl1 T A 4: 25,262,316 N310I probably damaging Het
Ush2a C A 1: 188,443,219 N1171K possibly damaging Het
Utrn A T 10: 12,699,087 V1032E probably benign Het
Other mutations in Myh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Myh7 APN 14 54987388 missense probably damaging 1.00
IGL01025:Myh7 APN 14 54979537 missense probably damaging 1.00
IGL01092:Myh7 APN 14 54971632 missense possibly damaging 0.91
IGL01384:Myh7 APN 14 54971459 missense probably damaging 1.00
IGL01457:Myh7 APN 14 54988879 missense possibly damaging 0.66
IGL01671:Myh7 APN 14 54972924 missense probably damaging 1.00
IGL01923:Myh7 APN 14 54985459 critical splice donor site probably null
IGL02183:Myh7 APN 14 54974731 missense probably benign
IGL02379:Myh7 APN 14 54979468 missense probably damaging 1.00
IGL02884:Myh7 APN 14 54992819 missense probably benign 0.26
IGL02898:Myh7 APN 14 54983740 missense probably damaging 1.00
IGL03027:Myh7 APN 14 54983550 missense probably damaging 1.00
IGL03061:Myh7 APN 14 54991204 unclassified probably benign
IGL03145:Myh7 APN 14 54983345 missense probably damaging 1.00
IGL03250:Myh7 APN 14 54992247 missense probably damaging 1.00
IGL03394:Myh7 APN 14 54975361 missense probably damaging 1.00
R0019:Myh7 UTSW 14 54983734 missense possibly damaging 0.91
R0030:Myh7 UTSW 14 54991970 missense probably benign 0.00
R0183:Myh7 UTSW 14 54978876 missense probably benign 0.02
R0230:Myh7 UTSW 14 54973933 missense probably benign 0.03
R0295:Myh7 UTSW 14 54984821 splice site probably benign
R0423:Myh7 UTSW 14 54979189 missense probably benign 0.06
R0537:Myh7 UTSW 14 54990799 missense possibly damaging 0.81
R0541:Myh7 UTSW 14 54974701 missense probably benign
R0581:Myh7 UTSW 14 54985496 missense probably benign 0.02
R0786:Myh7 UTSW 14 54992873 start codon destroyed probably null
R0866:Myh7 UTSW 14 54973139 missense probably benign
R1068:Myh7 UTSW 14 54987319 missense possibly damaging 0.93
R1075:Myh7 UTSW 14 54987403 missense probably benign
R1124:Myh7 UTSW 14 54973870 missense possibly damaging 0.78
R1140:Myh7 UTSW 14 54972882 missense probably damaging 1.00
R1260:Myh7 UTSW 14 54988451 missense probably benign 0.00
R1653:Myh7 UTSW 14 54990789 missense probably benign 0.00
R1677:Myh7 UTSW 14 54987516 missense probably benign 0.17
R1760:Myh7 UTSW 14 54972713 missense probably damaging 1.00
R1838:Myh7 UTSW 14 54973180 missense possibly damaging 0.91
R1839:Myh7 UTSW 14 54973180 missense possibly damaging 0.91
R2483:Myh7 UTSW 14 54973381 missense probably damaging 0.99
R2566:Myh7 UTSW 14 54983242 missense probably damaging 1.00
R3623:Myh7 UTSW 14 54973381 missense probably damaging 0.99
R3916:Myh7 UTSW 14 54974046 missense probably damaging 0.97
R4236:Myh7 UTSW 14 54991118 missense probably benign 0.34
R4471:Myh7 UTSW 14 54991854 nonsense probably null
R4700:Myh7 UTSW 14 54988321 missense possibly damaging 0.85
R4805:Myh7 UTSW 14 54985133 missense probably benign 0.27
R4880:Myh7 UTSW 14 54978588 missense probably benign 0.18
R4975:Myh7 UTSW 14 54971671 missense probably damaging 1.00
R4982:Myh7 UTSW 14 54972767 missense probably damaging 0.98
R5004:Myh7 UTSW 14 54971683 missense probably damaging 0.99
R5107:Myh7 UTSW 14 54986424 intron probably benign
R5124:Myh7 UTSW 14 54985742 nonsense probably null
R5256:Myh7 UTSW 14 54979508 missense probably damaging 1.00
R5335:Myh7 UTSW 14 54986563 intron probably benign
R5581:Myh7 UTSW 14 54978954 missense probably benign 0.00
R5861:Myh7 UTSW 14 54988890 missense possibly damaging 0.89
R5957:Myh7 UTSW 14 54989078 missense probably damaging 1.00
R6027:Myh7 UTSW 14 54970802 missense probably benign 0.01
R6184:Myh7 UTSW 14 54988858 missense probably damaging 1.00
R6232:Myh7 UTSW 14 54989296 missense probably benign 0.00
R6268:Myh7 UTSW 14 54989284 missense probably benign 0.00
R6274:Myh7 UTSW 14 54979486 missense probably damaging 0.97
R6345:Myh7 UTSW 14 54983692 missense probably damaging 1.00
R6383:Myh7 UTSW 14 54988894 missense probably benign 0.00
R6641:Myh7 UTSW 14 54982280 missense probably benign 0.37
R6952:Myh7 UTSW 14 54991740 missense probably damaging 1.00
R7025:Myh7 UTSW 14 54974644 nonsense probably null
R7201:Myh7 UTSW 14 54990945 missense possibly damaging 0.58
R7257:Myh7 UTSW 14 54972490 intron probably null
R7296:Myh7 UTSW 14 54990025 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TACTCCTTGGACACAGAGCAG -3'
(R):5'- GGGGTCCAAACTCTCCCAAAAG -3'

Sequencing Primer
(F):5'- TTGGACACAGAGCAGGCAGG -3'
(R):5'- AACATCTAACTCCAGTCTCTCCTCAG -3'
Posted On2018-08-01