Incidental Mutation 'R6755:Adcy5'
ID531040
Institutional Source Beutler Lab
Gene Symbol Adcy5
Ensembl Gene ENSMUSG00000022840
Gene Nameadenylate cyclase 5
SynonymsAC5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R6755 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location35154877-35305738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35303634 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 1228 (V1228M)
Ref Sequence ENSEMBL: ENSMUSP00000110563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114913]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114913
AA Change: V1228M

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110563
Gene: ENSMUSG00000022840
AA Change: V1228M

DomainStartEndE-ValueType
low complexity region 47 59 N/A INTRINSIC
low complexity region 75 89 N/A INTRINSIC
low complexity region 107 150 N/A INTRINSIC
low complexity region 158 175 N/A INTRINSIC
low complexity region 181 208 N/A INTRINSIC
low complexity region 243 258 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 305 320 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
CYCc 424 623 2.62e-69 SMART
Pfam:DUF1053 669 762 1.8e-30 PFAM
transmembrane domain 794 816 N/A INTRINSIC
transmembrane domain 837 856 N/A INTRINSIC
transmembrane domain 910 932 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 985 1004 N/A INTRINSIC
CYCc 1032 1240 2.98e-50 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-bound adenylyl cyclase enzymes. Adenylyl cyclases mediate G protein-coupled receptor signaling through the synthesis of the second messenger cAMP. Activity of the encoded protein is stimulated by the Gs alpha subunit of G protein-coupled receptors and is inhibited by protein kinase A, calcium and Gi alpha subunits. Single nucleotide polymorphisms in this gene may be associated with low birth weight and type 2 diabetes. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Targeted inactivation of this gene has been shown to result in motor dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,164,972 T364A probably benign Het
2210408I21Rik C T 13: 77,327,875 T1101M probably benign Het
4930433I11Rik T C 7: 40,994,310 S468P probably damaging Het
AA792892 A G 5: 94,381,409 T13A probably benign Het
Adam33 A G 2: 131,053,149 V637A probably damaging Het
Ahi1 G T 10: 21,017,913 V848F probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
B4galt6 T C 18: 20,689,329 E264G probably benign Het
Bpifb4 A G 2: 153,957,738 T556A probably damaging Het
Bptf A T 11: 107,047,256 S64T probably benign Het
C3ar1 A G 6: 122,849,858 S467P probably benign Het
Cables1 G T 18: 11,939,825 S479I probably null Het
Cbl T C 9: 44,173,374 I155V probably damaging Het
Cdh16 T C 8: 104,619,248 D297G probably damaging Het
Cdk8 T A 5: 146,268,316 H102Q probably damaging Het
Cpn2 A T 16: 30,260,331 L184Q probably damaging Het
Ctso T A 3: 81,942,302 H109Q probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drc1 A G 5: 30,355,146 E299G probably damaging Het
Elp6 A G 9: 110,315,825 E150G possibly damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fbn2 A G 18: 58,113,333 L499S possibly damaging Het
Fgf10 C A 13: 118,789,285 A200D probably damaging Het
Fhad1 T C 4: 141,964,604 E407G probably damaging Het
Hif1an T C 19: 44,568,452 V232A probably damaging Het
Ift172 T A 5: 31,260,998 K1214* probably null Het
Il20ra T C 10: 19,750,794 Y189H probably benign Het
Isg20l2 T A 3: 87,931,689 I69N probably benign Het
Kdelc1 C T 1: 44,110,734 probably null Het
Kif11 A G 19: 37,409,751 D675G probably benign Het
Klhdc7a T A 4: 139,966,475 D387V possibly damaging Het
Lrrc4 T C 6: 28,831,293 N108D probably damaging Het
Ltbp2 T A 12: 84,795,073 E944V probably damaging Het
Magi1 C T 6: 93,708,177 S740N probably damaging Het
Med26 A G 8: 72,495,833 I474T probably damaging Het
Mgst1 T A 6: 138,147,772 M68K probably damaging Het
Myh7 G A 14: 54,992,313 A91V possibly damaging Het
Nhlrc2 G A 19: 56,591,784 V450I probably benign Het
Nup160 T G 2: 90,700,456 F486C probably damaging Het
Obscn A T 11: 59,103,326 Y1602N probably damaging Het
Olfr629 T A 7: 103,740,500 T247S probably damaging Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otogl A T 10: 107,853,303 Y955* probably null Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pianp T C 6: 124,999,384 V52A probably benign Het
Plekhh2 T C 17: 84,591,585 Y997H probably damaging Het
Plekhm1 G T 11: 103,387,243 S342R possibly damaging Het
Ppp4r4 T A 12: 103,585,737 V81E probably damaging Het
Ptafr A G 4: 132,579,346 T16A probably benign Het
Ptpn23 A T 9: 110,389,787 L445Q probably damaging Het
Rasa1 A T 13: 85,226,598 F751L possibly damaging Het
Sap18 A C 14: 57,802,017 D153A probably damaging Het
Slc38a11 C T 2: 65,363,891 G10D probably benign Het
Snx32 T C 19: 5,510,344 N10D probably benign Het
Sox6 T C 7: 115,662,442 T180A probably damaging Het
Srrt T C 5: 137,302,930 K78R probably damaging Het
Syce3 T C 15: 89,397,364 D24G probably damaging Het
Taok3 T A 5: 117,206,667 I153N probably damaging Het
Tesk1 A G 4: 43,445,991 Q308R probably benign Het
Tm7sf3 A T 6: 146,609,973 probably null Het
Tmbim6 T C 15: 99,402,153 V50A probably benign Het
Tmem107 T C 11: 69,071,011 V22A probably damaging Het
Ttc12 T C 9: 49,453,346 I377V probably benign Het
Ufl1 T A 4: 25,262,316 N310I probably damaging Het
Ush2a C A 1: 188,443,219 N1171K possibly damaging Het
Utrn A T 10: 12,699,087 V1032E probably benign Het
Other mutations in Adcy5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Adcy5 APN 16 35253213 missense possibly damaging 0.49
IGL01583:Adcy5 APN 16 35283513 splice site probably benign
IGL01608:Adcy5 APN 16 35272165 missense probably damaging 1.00
IGL02097:Adcy5 APN 16 35272098 missense probably damaging 1.00
IGL02122:Adcy5 APN 16 35283612 splice site probably benign
IGL02532:Adcy5 APN 16 35272083 missense possibly damaging 0.79
IGL02814:Adcy5 APN 16 35303649 missense probably benign 0.08
IGL02877:Adcy5 APN 16 35298600 missense probably damaging 1.00
IGL03026:Adcy5 APN 16 35157042 missense probably benign 0.41
IGL03345:Adcy5 APN 16 35248814 missense probably benign 0.05
H8562:Adcy5 UTSW 16 35267181 missense probably damaging 1.00
H8786:Adcy5 UTSW 16 35267181 missense probably damaging 1.00
R0050:Adcy5 UTSW 16 35304303 utr 3 prime probably benign
R0091:Adcy5 UTSW 16 35270998 critical splice donor site probably null
R0112:Adcy5 UTSW 16 35156178 missense possibly damaging 0.85
R0398:Adcy5 UTSW 16 35269068 missense probably damaging 1.00
R0457:Adcy5 UTSW 16 35274545 missense probably benign 0.07
R0554:Adcy5 UTSW 16 35294017 missense probably benign 0.26
R0698:Adcy5 UTSW 16 35290082 missense possibly damaging 0.78
R0761:Adcy5 UTSW 16 35270825 splice site probably benign
R0865:Adcy5 UTSW 16 35274471 missense probably damaging 0.96
R0927:Adcy5 UTSW 16 35156243 missense probably benign 0.32
R0945:Adcy5 UTSW 16 35290111 missense probably benign
R1534:Adcy5 UTSW 16 35253259 missense possibly damaging 0.92
R1565:Adcy5 UTSW 16 35268957 missense probably damaging 1.00
R1721:Adcy5 UTSW 16 35298424 missense probably damaging 1.00
R1839:Adcy5 UTSW 16 35248940 missense probably damaging 1.00
R2047:Adcy5 UTSW 16 35290108 missense possibly damaging 0.78
R3052:Adcy5 UTSW 16 35303716 missense probably damaging 1.00
R3053:Adcy5 UTSW 16 35303716 missense probably damaging 1.00
R3827:Adcy5 UTSW 16 35290097 missense probably benign 0.03
R4398:Adcy5 UTSW 16 35268993 missense probably damaging 1.00
R4700:Adcy5 UTSW 16 35279216 missense possibly damaging 0.49
R4965:Adcy5 UTSW 16 35278502 missense possibly damaging 0.82
R5229:Adcy5 UTSW 16 35269070 missense probably damaging 0.99
R5456:Adcy5 UTSW 16 35298522 missense probably damaging 1.00
R5586:Adcy5 UTSW 16 35157116 missense probably damaging 0.99
R5757:Adcy5 UTSW 16 35272081 missense probably damaging 1.00
R5959:Adcy5 UTSW 16 35298410 missense probably damaging 1.00
R6011:Adcy5 UTSW 16 35157228 missense probably benign 0.05
R6277:Adcy5 UTSW 16 35289526 missense probably benign 0.02
R6296:Adcy5 UTSW 16 35303710 missense probably damaging 1.00
R6379:Adcy5 UTSW 16 35293999 missense probably benign 0.13
R6431:Adcy5 UTSW 16 35279237 missense probably damaging 1.00
R6685:Adcy5 UTSW 16 35279216 missense possibly damaging 0.49
R6728:Adcy5 UTSW 16 35157165 missense possibly damaging 0.88
R6887:Adcy5 UTSW 16 35298590 missense possibly damaging 0.74
R7029:Adcy5 UTSW 16 35299648 missense probably null 0.91
R7047:Adcy5 UTSW 16 35267215 missense probably damaging 1.00
R7050:Adcy5 UTSW 16 35303700 missense possibly damaging 0.88
R7102:Adcy5 UTSW 16 35299625 missense probably damaging 1.00
R7150:Adcy5 UTSW 16 35298534 missense probably damaging 1.00
R7242:Adcy5 UTSW 16 35156835 missense probably damaging 1.00
R7387:Adcy5 UTSW 16 35272090 missense probably damaging 1.00
V7732:Adcy5 UTSW 16 35283541 missense probably benign 0.00
X0022:Adcy5 UTSW 16 35299456 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCATTGTCCCCAAGAGCCAG -3'
(R):5'- CTGAGTCAAAGTGGGAATTTTACC -3'

Sequencing Primer
(F):5'- TCCCCAAGAGCCAGTGGTG -3'
(R):5'- TGGGAATTTTACCAGCACAGC -3'
Posted On2018-08-01