Incidental Mutation 'R6757:A830018L16Rik'
List |< first << previous [record 26 of 958] next >> last >|
ID531079
Institutional Source Beutler Lab
Gene Symbol A830018L16Rik
Ensembl Gene ENSMUSG00000057715
Gene NameRIKEN cDNA A830018L16 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R6757 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location11414105-11975901 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to T at 11596334 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tyrosine at position 288 (*288Y)
Ref Sequence ENSEMBL: ENSMUSP00000119143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048613] [ENSMUST00000135014] [ENSMUST00000137824] [ENSMUST00000141512] [ENSMUST00000171690] [ENSMUST00000179089]
Predicted Effect probably benign
Transcript: ENSMUST00000048613
SMART Domains Protein: ENSMUSP00000043857
Gene: ENSMUSG00000057715

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
low complexity region 233 248 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135014
AA Change: *288Y
SMART Domains Protein: ENSMUSP00000119143
Gene: ENSMUSG00000057715
AA Change: *288Y

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
low complexity region 233 248 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137824
SMART Domains Protein: ENSMUSP00000117421
Gene: ENSMUSG00000057715

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
low complexity region 233 248 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141339
SMART Domains Protein: ENSMUSP00000121311
Gene: ENSMUSG00000057715

DomainStartEndE-ValueType
low complexity region 110 120 N/A INTRINSIC
low complexity region 130 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141512
SMART Domains Protein: ENSMUSP00000139635
Gene: ENSMUSG00000057715

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171690
SMART Domains Protein: ENSMUSP00000132334
Gene: ENSMUSG00000057715

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
low complexity region 233 248 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191437
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to the cyclic AMP dependent protein kinase regulators. Naturally occurring mutations in this gene are associated with an increased risk for severe toxicities, such as diarrhea and neutropenia, in patients undergoing chemotherapeutic treatment. [provided by RefSeq, Mar 2017]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik G A 7: 34,239,077 A799V possibly damaging Het
Art2a-ps G T 7: 101,555,014 L106I probably benign Het
Bmi1 C T 2: 18,684,029 T203M probably damaging Het
Cpm A G 10: 117,671,638 D220G probably damaging Het
Cyp2a22 A C 7: 26,939,204 D52E probably benign Het
Dag1 A C 9: 108,218,017 I92S probably damaging Het
Dntt A T 19: 41,037,162 H73L probably damaging Het
Epha5 A C 5: 84,105,878 I716S probably damaging Het
Fpr-rs4 C T 17: 18,022,132 Q134* probably null Het
Fzd8 T A 18: 9,213,238 C107S possibly damaging Het
Gm597 A C 1: 28,780,110 I30S probably damaging Het
Gnptab T C 10: 88,437,502 L1047P probably damaging Het
Gstt1 A T 10: 75,798,383 probably null Het
Kdm2a T C 19: 4,319,243 R1115G probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myo1b C T 1: 51,813,048 E179K probably damaging Het
Nrp1 T A 8: 128,425,868 I186N probably damaging Het
Olfr1512 A G 14: 52,372,715 C113R probably damaging Het
Pole T C 5: 110,303,610 V835A probably damaging Het
Shprh A G 10: 11,181,508 probably null Het
Slc39a14 A T 14: 70,310,884 L238Q probably damaging Het
Usp40 A T 1: 87,980,037 I619N probably damaging Het
Other mutations in A830018L16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:A830018L16Rik APN 1 11748054 missense probably damaging 0.98
IGL01916:A830018L16Rik APN 1 11748107 splice site probably benign
IGL02040:A830018L16Rik APN 1 11933598 intron probably benign
IGL02432:A830018L16Rik APN 1 11748079 missense probably damaging 1.00
IGL02693:A830018L16Rik APN 1 11596282 missense probably damaging 1.00
IGL02736:A830018L16Rik APN 1 11972051 missense probably benign 0.02
IGL03293:A830018L16Rik APN 1 11545151 splice site probably null
IGL02835:A830018L16Rik UTSW 1 11972055 missense possibly damaging 0.54
R1203:A830018L16Rik UTSW 1 11518594 missense probably damaging 1.00
R1216:A830018L16Rik UTSW 1 11798492 missense probably damaging 0.99
R1548:A830018L16Rik UTSW 1 11518594 missense probably damaging 1.00
R1644:A830018L16Rik UTSW 1 11414590 nonsense probably null
R1855:A830018L16Rik UTSW 1 11747971 missense probably damaging 1.00
R1858:A830018L16Rik UTSW 1 11974953 missense unknown
R2265:A830018L16Rik UTSW 1 11972104 critical splice donor site probably null
R2296:A830018L16Rik UTSW 1 11512051 missense possibly damaging 0.94
R2484:A830018L16Rik UTSW 1 11596302 missense probably damaging 1.00
R3730:A830018L16Rik UTSW 1 11545226 missense probably damaging 1.00
R3752:A830018L16Rik UTSW 1 11518680 missense probably damaging 1.00
R3861:A830018L16Rik UTSW 1 11588554 splice site probably benign
R4305:A830018L16Rik UTSW 1 11972076 nonsense probably null
R4306:A830018L16Rik UTSW 1 11972076 nonsense probably null
R4307:A830018L16Rik UTSW 1 11972076 nonsense probably null
R4558:A830018L16Rik UTSW 1 11972076 nonsense probably null
R4598:A830018L16Rik UTSW 1 11747964 critical splice acceptor site probably null
R4652:A830018L16Rik UTSW 1 11537342 intron probably benign
R5492:A830018L16Rik UTSW 1 11545207 missense probably damaging 0.99
R5493:A830018L16Rik UTSW 1 11545207 missense probably damaging 0.99
R5802:A830018L16Rik UTSW 1 11950964 missense probably damaging 1.00
R6007:A830018L16Rik UTSW 1 11511916 critical splice acceptor site probably null
R6082:A830018L16Rik UTSW 1 11798528 missense probably benign 0.04
R6376:A830018L16Rik UTSW 1 11798494 missense probably damaging 0.98
R6453:A830018L16Rik UTSW 1 11798558 missense possibly damaging 0.91
R6833:A830018L16Rik UTSW 1 11588509 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTAAAGATGGAGCCCAAGACG -3'
(R):5'- AGGATAGAGCGCTGCATATG -3'

Sequencing Primer
(F):5'- GCCCAAGACGAAAGGATTAAAAC -3'
(R):5'- CAGTCTAGGGAATGTTTCACATGC -3'
Posted On2018-08-01