Incidental Mutation 'R6758:Gm10801'
ID531103
Institutional Source Beutler Lab
Gene Symbol Gm10801
Ensembl Gene ENSMUSG00000075015
Gene Namepredicted gene 10801
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R6758 (G1)
Quality Score142.467
Status Not validated
Chromosome2
Chromosomal Location98662237-98664083 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to CGTG at 98663807 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099683] [ENSMUST00000099684]
Predicted Effect probably benign
Transcript: ENSMUST00000099683
SMART Domains Protein: ENSMUSP00000097275
Gene: ENSMUSG00000075014

DomainStartEndE-ValueType
internal_repeat_1 1 41 1.13e-5 PROSPERO
internal_repeat_2 26 49 4.11e-5 PROSPERO
transmembrane domain 78 96 N/A INTRINSIC
internal_repeat_1 114 174 1.13e-5 PROSPERO
low complexity region 177 188 N/A INTRINSIC
internal_repeat_2 197 219 4.11e-5 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000099684
SMART Domains Protein: ENSMUSP00000097276
Gene: ENSMUSG00000075015

DomainStartEndE-ValueType
internal_repeat_1 2 73 1.19e-13 PROSPERO
internal_repeat_1 80 167 1.19e-13 PROSPERO
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,588,475 probably null Het
Ankrd17 A T 5: 90,263,313 D1374E probably damaging Het
Cd96 C A 16: 46,118,004 V33L possibly damaging Het
Drd1 T C 13: 54,053,289 E295G probably benign Het
Fzd8 T A 18: 9,213,238 C107S possibly damaging Het
Gm11595 C A 11: 99,772,540 V105L unknown Het
Gm11595 A T 11: 99,772,541 C104* probably null Het
Igsf3 T C 3: 101,425,498 Y31H probably damaging Het
Ikzf2 A T 1: 69,538,900 H483Q probably damaging Het
Itgbl1 A G 14: 123,857,489 K309E probably benign Het
Myt1l T G 12: 29,842,600 Y79D possibly damaging Het
Nid2 T A 14: 19,802,483 S1086R probably damaging Het
Olfr107 A G 17: 37,405,695 D49G probably damaging Het
Olfr192 T C 16: 59,098,965 E9G probably damaging Het
Olfr808 T C 10: 129,768,051 I185T probably damaging Het
Rorc A G 3: 94,387,518 N51S possibly damaging Het
Simc1 C T 13: 54,525,548 P570S possibly damaging Het
Smn1 T A 13: 100,132,438 M264K possibly damaging Het
Tiam2 A G 17: 3,518,403 D1608G probably benign Het
Tll1 C A 8: 64,041,405 probably null Het
Trim15 A G 17: 36,862,341 L284P probably benign Het
Other mutations in Gm10801
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Gm10801 APN 2 98663983 missense probably benign
IGL01154:Gm10801 APN 2 98663983 missense probably benign
PIT4131001:Gm10801 UTSW 2 98662303 missense probably benign
PIT4142001:Gm10801 UTSW 2 98662303 missense probably benign
R0026:Gm10801 UTSW 2 98663909 splice site probably benign
R0063:Gm10801 UTSW 2 98663840 missense probably benign 0.30
R0334:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R0335:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R1172:Gm10801 UTSW 2 98663907 splice site probably benign
R1321:Gm10801 UTSW 2 98663907 splice site probably benign
R1871:Gm10801 UTSW 2 98663840 missense probably benign 0.30
R1924:Gm10801 UTSW 2 98663852 missense probably damaging 1.00
R2163:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R2306:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R2379:Gm10801 UTSW 2 98663840 missense probably benign 0.30
R3078:Gm10801 UTSW 2 98663852 missense probably damaging 1.00
R3605:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R3892:Gm10801 UTSW 2 98663901 splice site probably null
R3930:Gm10801 UTSW 2 98664016 missense possibly damaging 0.48
R4638:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R4709:Gm10801 UTSW 2 98663901 splice site probably null
R5390:Gm10801 UTSW 2 98663806 small insertion probably benign
R5405:Gm10801 UTSW 2 98663806 small insertion probably benign
R5535:Gm10801 UTSW 2 98662499 frame shift probably null
R5653:Gm10801 UTSW 2 98664051 missense probably damaging 1.00
R5747:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R5987:Gm10801 UTSW 2 98663807 nonsense probably null
R6086:Gm10801 UTSW 2 98663803 nonsense probably null
R6090:Gm10801 UTSW 2 98663806 small insertion probably benign
R6093:Gm10801 UTSW 2 98663807 nonsense probably null
R6112:Gm10801 UTSW 2 98664064 missense probably benign 0.00
R6184:Gm10801 UTSW 2 98663806 small insertion probably benign
R6352:Gm10801 UTSW 2 98663806 small insertion probably benign
R6357:Gm10801 UTSW 2 98663807 frame shift probably null
R6395:Gm10801 UTSW 2 98663807 small insertion probably benign
R6514:Gm10801 UTSW 2 98663869 missense probably benign 0.19
R6547:Gm10801 UTSW 2 98663803 nonsense probably null
R6560:Gm10801 UTSW 2 98663807 nonsense probably null
R6640:Gm10801 UTSW 2 98663807 nonsense probably null
R6675:Gm10801 UTSW 2 98663806 small insertion probably benign
R6679:Gm10801 UTSW 2 98663806 small insertion probably benign
R6684:Gm10801 UTSW 2 98663807 nonsense probably null
R6786:Gm10801 UTSW 2 98663803 nonsense probably null
R6886:Gm10801 UTSW 2 98663806 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ATCTGTGTAGAAAGCTGTTGCTC -3'
(R):5'- ACTTTCTCTAGCCCCGGAAAC -3'

Sequencing Primer
(F):5'- TGGCTCAATGGCAGAGTGC -3'
(R):5'- ATGCACACTGTAAGACCTGG -3'
Posted On2018-08-01