Incidental Mutation 'R6758:0610010F05Rik'
List |< first << previous [record 41 of 415570] next >> last >|
ID531109
Institutional Source Beutler Lab
Gene Symbol 0610010F05Rik
Ensembl Gene ENSMUSG00000042208
Gene NameRIKEN cDNA 0610010F05 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R6758 (G1)
Quality Score97.0078
Status Not validated
Chromosome11
Chromosomal Location23564961-23633639 bp(-) (GRCm38)
Type of Mutationintron (160 bp from exon)
DNA Base Change (assembly) T to C at 23588475 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043356] [ENSMUST00000093267] [ENSMUST00000109532] [ENSMUST00000123909] [ENSMUST00000155903] [ENSMUST00000180260]
Predicted Effect probably null
Transcript: ENSMUST00000043356
SMART Domains Protein: ENSMUSP00000044265
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 5.1e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000093267
SMART Domains Protein: ENSMUSP00000090955
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
Pfam:DUF3342 1 303 7.7e-107 PFAM
low complexity region 419 430 N/A INTRINSIC
low complexity region 433 450 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109532
SMART Domains Protein: ENSMUSP00000105158
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 5.1e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000123909
SMART Domains Protein: ENSMUSP00000117103
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
low complexity region 71 82 N/A INTRINSIC
low complexity region 85 102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155903
SMART Domains Protein: ENSMUSP00000137799
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 1e-106 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000180260
SMART Domains Protein: ENSMUSP00000136118
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 4.5e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 A T 5: 90,263,313 D1374E probably damaging Het
Cd96 C A 16: 46,118,004 V33L possibly damaging Het
Drd1 T C 13: 54,053,289 E295G probably benign Het
Fzd8 T A 18: 9,213,238 C107S possibly damaging Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm11595 C A 11: 99,772,540 V105L unknown Het
Gm11595 A T 11: 99,772,541 C104* probably null Het
Igsf3 T C 3: 101,425,498 Y31H probably damaging Het
Ikzf2 A T 1: 69,538,900 H483Q probably damaging Het
Itgbl1 A G 14: 123,857,489 K309E probably benign Het
Myt1l T G 12: 29,842,600 Y79D possibly damaging Het
Nid2 T A 14: 19,802,483 S1086R probably damaging Het
Olfr107 A G 17: 37,405,695 D49G probably damaging Het
Olfr192 T C 16: 59,098,965 E9G probably damaging Het
Olfr808 T C 10: 129,768,051 I185T probably damaging Het
Rorc A G 3: 94,387,518 N51S possibly damaging Het
Simc1 C T 13: 54,525,548 P570S possibly damaging Het
Smn1 T A 13: 100,132,438 M264K possibly damaging Het
Tiam2 A G 17: 3,518,403 D1608G probably benign Het
Tll1 C A 8: 64,041,405 probably null Het
Trim15 A G 17: 36,862,341 L284P probably benign Het
Other mutations in 0610010F05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:0610010F05Rik APN 11 23595434 missense probably damaging 1.00
IGL01444:0610010F05Rik APN 11 23620225 splice site probably benign
IGL01522:0610010F05Rik APN 11 23582865 critical splice donor site probably null
IGL01819:0610010F05Rik APN 11 23584561 missense probably benign 0.29
IGL02470:0610010F05Rik APN 11 23615222 missense probably damaging 0.99
IGL03046:0610010F05Rik UTSW 11 23615150 missense possibly damaging 0.77
R0139:0610010F05Rik UTSW 11 23620214 splice site probably benign
R0334:0610010F05Rik UTSW 11 23617129 splice site probably benign
R0646:0610010F05Rik UTSW 11 23575491 missense probably damaging 0.99
R1078:0610010F05Rik UTSW 11 23611762 missense probably benign 0.45
R1263:0610010F05Rik UTSW 11 23620278 nonsense probably null
R1471:0610010F05Rik UTSW 11 23615222 missense probably damaging 0.99
R1568:0610010F05Rik UTSW 11 23589971 missense probably damaging 1.00
R2163:0610010F05Rik UTSW 11 23576826 splice site probably benign
R2318:0610010F05Rik UTSW 11 23588701 missense probably damaging 1.00
R2426:0610010F05Rik UTSW 11 23576801 missense probably damaging 1.00
R4373:0610010F05Rik UTSW 11 23615265 splice site probably null
R4688:0610010F05Rik UTSW 11 23593449 missense probably benign
R4816:0610010F05Rik UTSW 11 23615243 missense possibly damaging 0.67
R5046:0610010F05Rik UTSW 11 23620354 missense probably benign 0.23
R5156:0610010F05Rik UTSW 11 23593424 critical splice donor site probably null
R5249:0610010F05Rik UTSW 11 23575483 makesense probably null
R5615:0610010F05Rik UTSW 11 23606759 missense probably damaging 0.96
R6860:0610010F05Rik UTSW 11 23625100 missense probably damaging 1.00
R6910:0610010F05Rik UTSW 11 23620447 missense probably damaging 0.99
X0026:0610010F05Rik UTSW 11 23576767 missense probably benign 0.00
X0067:0610010F05Rik UTSW 11 23593420 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGTACACACAGAGCACCAGG -3'
(R):5'- TTCTCAGAAGAGGAAGAGTATACCACG -3'

Sequencing Primer
(F):5'- CACACAGAGCACCAGGGTTTATTTTC -3'
(R):5'- TCTGAGGTCACTGAAGATGAAGTC -3'
Posted On2018-08-01