Incidental Mutation 'R6759:Cyp4a30b'
ID531131
Institutional Source Beutler Lab
Gene Symbol Cyp4a30b
Ensembl Gene ENSMUSG00000084346
Gene Namecytochrome P450, family 4, subfamily a, polypeptide 30b
SynonymsCyp4a30b-ps, OTTMUSG00000008626
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6759 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location115452604-115471062 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 115461374 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 426 (A426V)
Ref Sequence ENSEMBL: ENSMUSP00000140857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119958]
Predicted Effect probably benign
Transcript: ENSMUST00000119958
AA Change: A426V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000140857
Gene: ENSMUSG00000084346
AA Change: A426V

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 52 503 1.4e-119 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,183,826 S841G probably benign Het
4932438A13Rik C T 3: 36,988,085 T2740I possibly damaging Het
4933427I04Rik G T 4: 123,860,086 probably benign Het
Aak1 A G 6: 86,944,417 T199A probably damaging Het
Acnat2 C A 4: 49,380,254 V375L probably benign Het
Aldh1a7 T C 19: 20,699,956 T434A possibly damaging Het
Aldh3a2 T C 11: 61,265,262 T63A probably benign Het
Anxa2 T C 9: 69,483,821 S97P probably damaging Het
Apip T C 2: 103,091,846 S186P probably benign Het
Apob A G 12: 8,011,049 K3177R probably benign Het
Atm C T 9: 53,518,559 W392* probably null Het
Atp8b1 T A 18: 64,546,090 R773S probably benign Het
Bicdl2 T A 17: 23,666,744 probably null Het
Cacng3 G A 7: 122,762,324 probably null Het
Clca3a1 G T 3: 144,749,689 L448M probably damaging Het
Clk4 A G 11: 51,275,574 I94M possibly damaging Het
Cnot3 G T 7: 3,651,919 V124F probably damaging Het
Dact1 T A 12: 71,318,137 L564* probably null Het
Dnah8 T A 17: 30,663,292 probably null Het
Dock5 T A 14: 67,795,996 T975S probably benign Het
Dock8 C A 19: 25,127,484 H739Q probably damaging Het
Efr3b T A 12: 3,984,613 N186Y probably damaging Het
Enam G A 5: 88,501,691 G278D probably damaging Het
Fgl2 A G 5: 21,373,258 D181G probably benign Het
Gfra3 G T 18: 34,695,873 S156* probably null Het
Jam3 G C 9: 27,101,980 T98S probably benign Het
Ltbp2 A T 12: 84,787,410 I1435N probably damaging Het
Man2a1 G A 17: 64,625,388 A157T probably benign Het
Mcm3ap T A 10: 76,501,314 V1361E probably benign Het
Nobox A T 6: 43,307,604 L36Q possibly damaging Het
Olfr642 A G 7: 104,050,127 S76P probably damaging Het
Olfr693 T A 7: 106,677,893 M198L probably benign Het
Parp4 G A 14: 56,620,490 V860I probably benign Het
Pim3 T A 15: 88,863,093 probably null Het
Ptpn13 A T 5: 103,565,255 N1748I possibly damaging Het
Rad51ap2 A G 12: 11,457,144 T356A possibly damaging Het
Ranbp2 C T 10: 58,457,737 R310* probably null Het
Rassf5 C T 1: 131,182,251 V190I probably benign Het
Rgl1 T G 1: 152,533,530 Q481P probably damaging Het
Rrp1b A G 17: 32,057,089 T537A probably benign Het
Smok3c T A 5: 138,065,437 S395R probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Strn4 A T 7: 16,823,053 E145V probably damaging Het
Tex21 T A 12: 76,204,312 probably null Het
Usp37 G A 1: 74,495,749 R13* probably null Het
Uty G T Y: 1,174,735 L222I probably damaging Homo
Wwp2 A G 8: 107,540,682 T309A probably damaging Het
Zfp40 C T 17: 23,176,536 R359H possibly damaging Het
Other mutations in Cyp4a30b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03184:Cyp4a30b APN 4 115459019 missense probably damaging 1.00
IGL03233:Cyp4a30b APN 4 115458970 missense probably benign 0.08
R1394:Cyp4a30b UTSW 4 115470892 critical splice acceptor site probably null
R2870:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R2870:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R2871:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R2871:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R2872:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R2872:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R2873:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R3818:Cyp4a30b UTSW 4 115459009 missense probably damaging 1.00
R4052:Cyp4a30b UTSW 4 115454342 missense probably benign 0.00
R4684:Cyp4a30b UTSW 4 115455003 missense probably damaging 1.00
R5558:Cyp4a30b UTSW 4 115458866 missense probably damaging 1.00
R5997:Cyp4a30b UTSW 4 115459391 nonsense probably null
R6242:Cyp4a30b UTSW 4 115454390 missense possibly damaging 0.48
R6511:Cyp4a30b UTSW 4 115456708 missense probably damaging 1.00
R7285:Cyp4a30b UTSW 4 115456651 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATTGCCATTTTCTAGTGGATTC -3'
(R):5'- ACCTTGTTCCTGCTGAGAAGG -3'

Sequencing Primer
(F):5'- CCCCAATAAGATCAATTTGCTCAATG -3'
(R):5'- TCCTGCTGAGAAGGGTAGG -3'
Posted On2018-08-01