Incidental Mutation 'R6759:Ak9'
List |< first << previous [record 68 of 1259] next >> last >|
ID531149
Institutional Source Beutler Lab
Gene Symbol Ak9
Ensembl Gene ENSMUSG00000091415
Gene Nameadenylate kinase 9
SynonymsLOC215946, Akd1, Gm7127, Akd2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6759 (G1)
Quality Score191.468
Status Not validated
Chromosome10
Chromosomal Location41303980-41434534 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GGAGAGAGAGA to GGAGAGAGAGAGA at 41402270 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173494]
Predicted Effect probably null
Transcript: ENSMUST00000173494
SMART Domains Protein: ENSMUSP00000134177
Gene: ENSMUSG00000091415

DomainStartEndE-ValueType
AAA 30 330 4.65e-3 SMART
AAA 391 733 9.11e-1 SMART
Pfam:DUF3508 812 971 1.4e-7 PFAM
AAA 974 1297 1.2e-1 SMART
Blast:AAA 1326 1388 8e-18 BLAST
AAA 1393 1824 1.44e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214384
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the interconversion of nucleosides, possessing both nucleoside monophosphate and diphosphate kinase activities. The encoded protein uses these interconversions to maintain nucleoside homeostasis. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,183,826 S841G probably benign Het
4932438A13Rik C T 3: 36,988,085 T2740I possibly damaging Het
4933427I04Rik G T 4: 123,860,086 probably benign Het
Aak1 A G 6: 86,944,417 T199A probably damaging Het
Acnat2 C A 4: 49,380,254 V375L probably benign Het
Aldh1a7 T C 19: 20,699,956 T434A possibly damaging Het
Aldh3a2 T C 11: 61,265,262 T63A probably benign Het
Anxa2 T C 9: 69,483,821 S97P probably damaging Het
Apip T C 2: 103,091,846 S186P probably benign Het
Apob A G 12: 8,011,049 K3177R probably benign Het
Atm C T 9: 53,518,559 W392* probably null Het
Atp8b1 T A 18: 64,546,090 R773S probably benign Het
Bicdl2 T A 17: 23,666,744 probably null Het
Cacng3 G A 7: 122,762,324 probably null Het
Clca3a1 G T 3: 144,749,689 L448M probably damaging Het
Clk4 A G 11: 51,275,574 I94M possibly damaging Het
Cnot3 G T 7: 3,651,919 V124F probably damaging Het
Cyp4a30b C T 4: 115,461,374 A426V probably benign Het
Dact1 T A 12: 71,318,137 L564* probably null Het
Dnah8 T A 17: 30,663,292 probably null Het
Dock5 T A 14: 67,795,996 T975S probably benign Het
Dock8 C A 19: 25,127,484 H739Q probably damaging Het
Efr3b T A 12: 3,984,613 N186Y probably damaging Het
Enam G A 5: 88,501,691 G278D probably damaging Het
Fgl2 A G 5: 21,373,258 D181G probably benign Het
Gfra3 G T 18: 34,695,873 S156* probably null Het
Jam3 G C 9: 27,101,980 T98S probably benign Het
Ltbp2 A T 12: 84,787,410 I1435N probably damaging Het
Man2a1 G A 17: 64,625,388 A157T probably benign Het
Mcm3ap T A 10: 76,501,314 V1361E probably benign Het
Nobox A T 6: 43,307,604 L36Q possibly damaging Het
Olfr642 A G 7: 104,050,127 S76P probably damaging Het
Olfr693 T A 7: 106,677,893 M198L probably benign Het
Parp4 G A 14: 56,620,490 V860I probably benign Het
Pim3 T A 15: 88,863,093 probably null Het
Ptpn13 A T 5: 103,565,255 N1748I possibly damaging Het
Rad51ap2 A G 12: 11,457,144 T356A possibly damaging Het
Ranbp2 C T 10: 58,457,737 R310* probably null Het
Rassf5 C T 1: 131,182,251 V190I probably benign Het
Rgl1 T G 1: 152,533,530 Q481P probably damaging Het
Rrp1b A G 17: 32,057,089 T537A probably benign Het
Smok3c T A 5: 138,065,437 S395R probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Strn4 A T 7: 16,823,053 E145V probably damaging Het
Tex21 T A 12: 76,204,312 probably null Het
Usp37 G A 1: 74,495,749 R13* probably null Het
Uty G T Y: 1,174,735 L222I probably damaging Homo
Wwp2 A G 8: 107,540,682 T309A probably damaging Het
Zfp40 C T 17: 23,176,536 R359H possibly damaging Het
Other mutations in Ak9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0057:Ak9 UTSW 10 41392728 missense probably benign 0.04
R0605:Ak9 UTSW 10 41345139 missense probably damaging 1.00
R0658:Ak9 UTSW 10 41347222 missense probably damaging 0.98
R1696:Ak9 UTSW 10 41327589 missense possibly damaging 0.73
R1738:Ak9 UTSW 10 41335921 missense possibly damaging 0.86
R1815:Ak9 UTSW 10 41337576 missense probably damaging 1.00
R2900:Ak9 UTSW 10 41424755 missense unknown
R3123:Ak9 UTSW 10 41358580 missense possibly damaging 0.46
R3715:Ak9 UTSW 10 41357512 missense probably damaging 0.96
R4092:Ak9 UTSW 10 41389144 missense probably benign 0.29
R4193:Ak9 UTSW 10 41335945 missense probably benign 0.14
R4598:Ak9 UTSW 10 41383911 missense probably damaging 1.00
R4621:Ak9 UTSW 10 41406891 missense possibly damaging 0.55
R4681:Ak9 UTSW 10 41427238 missense unknown
R4707:Ak9 UTSW 10 41345460 missense probably benign 0.36
R4908:Ak9 UTSW 10 41420682 missense unknown
R4952:Ak9 UTSW 10 41420589 missense probably benign 0.07
R5162:Ak9 UTSW 10 41357657 missense probably damaging 1.00
R5446:Ak9 UTSW 10 41420509 missense possibly damaging 0.70
R5494:Ak9 UTSW 10 41347169 missense probably damaging 1.00
R5517:Ak9 UTSW 10 41340891 missense probably benign 0.23
R5849:Ak9 UTSW 10 41348049 missense probably benign 0.31
R5858:Ak9 UTSW 10 41423027 missense unknown
R5920:Ak9 UTSW 10 41420676 missense probably benign 0.30
R5952:Ak9 UTSW 10 41357563 missense possibly damaging 0.59
R5955:Ak9 UTSW 10 41358564 missense probably damaging 1.00
R6050:Ak9 UTSW 10 41389112 missense possibly damaging 0.74
R6087:Ak9 UTSW 10 41382832 missense probably benign 0.01
R6190:Ak9 UTSW 10 41422407 missense unknown
R6190:Ak9 UTSW 10 41422408 missense unknown
R6197:Ak9 UTSW 10 41317830 missense probably damaging 0.98
R6220:Ak9 UTSW 10 41370099 missense unknown
R6250:Ak9 UTSW 10 41389034 missense possibly damaging 0.54
R6315:Ak9 UTSW 10 41406841 missense possibly damaging 0.55
R6331:Ak9 UTSW 10 41382829 missense probably damaging 0.99
R6760:Ak9 UTSW 10 41402270 frame shift probably null
R6812:Ak9 UTSW 10 41367167 missense unknown
Predicted Primers PCR Primer
(F):5'- GGCAAGGATGTGCTAAGTCAGTC -3'
(R):5'- ACCCAGTGTGAGTTCCTGTAC -3'

Sequencing Primer
(F):5'- GGATGTGCTAAGTCAGTCACCATC -3'
(R):5'- TGTACACTTTTAAACACGGCC -3'
Posted On2018-08-01