Incidental Mutation 'R6759:Atp8b1'
ID531170
Institutional Source Beutler Lab
Gene Symbol Atp8b1
Ensembl Gene ENSMUSG00000039529
Gene NameATPase, class I, type 8B, member 1
SynonymsFIC1, Ic
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6759 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location64528979-64661000 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 64546090 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 773 (R773S)
Ref Sequence ENSEMBL: ENSMUSP00000025482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025482]
Predicted Effect probably benign
Transcript: ENSMUST00000025482
AA Change: R773S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025482
Gene: ENSMUSG00000039529
AA Change: R773S

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 65 144 5.3e-29 PFAM
Pfam:E1-E2_ATPase 146 413 6e-11 PFAM
Pfam:HAD 451 902 2.4e-21 PFAM
Pfam:Cation_ATPase 532 632 1e-12 PFAM
Pfam:PhoLip_ATPase_C 919 1173 7.3e-82 PFAM
low complexity region 1193 1207 N/A INTRINSIC
low complexity region 1221 1232 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the P-type cation transport ATPase family, which belongs to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. Mutations in this gene may result in progressive familial intrahepatic cholestasis type 1 and in benign recurrent intrahepatic cholestasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice display abnormal bile salt homeostasis, normal bile secretion, and an impaired ability to handle increased bile salt loading resulting in liver damage and weight loss on a bile salt supplemented diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,183,826 S841G probably benign Het
4932438A13Rik C T 3: 36,988,085 T2740I possibly damaging Het
4933427I04Rik G T 4: 123,860,086 probably benign Het
Aak1 A G 6: 86,944,417 T199A probably damaging Het
Acnat2 C A 4: 49,380,254 V375L probably benign Het
Aldh1a7 T C 19: 20,699,956 T434A possibly damaging Het
Aldh3a2 T C 11: 61,265,262 T63A probably benign Het
Anxa2 T C 9: 69,483,821 S97P probably damaging Het
Apip T C 2: 103,091,846 S186P probably benign Het
Apob A G 12: 8,011,049 K3177R probably benign Het
Atm C T 9: 53,518,559 W392* probably null Het
Bicdl2 T A 17: 23,666,744 probably null Het
Cacng3 G A 7: 122,762,324 probably null Het
Clca3a1 G T 3: 144,749,689 L448M probably damaging Het
Clk4 A G 11: 51,275,574 I94M possibly damaging Het
Cnot3 G T 7: 3,651,919 V124F probably damaging Het
Cyp4a30b C T 4: 115,461,374 A426V probably benign Het
Dact1 T A 12: 71,318,137 L564* probably null Het
Dnah8 T A 17: 30,663,292 probably null Het
Dock5 T A 14: 67,795,996 T975S probably benign Het
Dock8 C A 19: 25,127,484 H739Q probably damaging Het
Efr3b T A 12: 3,984,613 N186Y probably damaging Het
Enam G A 5: 88,501,691 G278D probably damaging Het
Fgl2 A G 5: 21,373,258 D181G probably benign Het
Gfra3 G T 18: 34,695,873 S156* probably null Het
Jam3 G C 9: 27,101,980 T98S probably benign Het
Ltbp2 A T 12: 84,787,410 I1435N probably damaging Het
Man2a1 G A 17: 64,625,388 A157T probably benign Het
Mcm3ap T A 10: 76,501,314 V1361E probably benign Het
Nobox A T 6: 43,307,604 L36Q possibly damaging Het
Olfr642 A G 7: 104,050,127 S76P probably damaging Het
Olfr693 T A 7: 106,677,893 M198L probably benign Het
Parp4 G A 14: 56,620,490 V860I probably benign Het
Pim3 T A 15: 88,863,093 probably null Het
Ptpn13 A T 5: 103,565,255 N1748I possibly damaging Het
Rad51ap2 A G 12: 11,457,144 T356A possibly damaging Het
Ranbp2 C T 10: 58,457,737 R310* probably null Het
Rassf5 C T 1: 131,182,251 V190I probably benign Het
Rgl1 T G 1: 152,533,530 Q481P probably damaging Het
Rrp1b A G 17: 32,057,089 T537A probably benign Het
Smok3c T A 5: 138,065,437 S395R probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Strn4 A T 7: 16,823,053 E145V probably damaging Het
Tex21 T A 12: 76,204,312 probably null Het
Usp37 G A 1: 74,495,749 R13* probably null Het
Uty G T Y: 1,174,735 L222I probably damaging Homo
Wwp2 A G 8: 107,540,682 T309A probably damaging Het
Zfp40 C T 17: 23,176,536 R359H possibly damaging Het
Other mutations in Atp8b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Atp8b1 APN 18 64564430 missense probably benign 0.23
IGL00907:Atp8b1 APN 18 64561705 missense possibly damaging 0.95
IGL00962:Atp8b1 APN 18 64531444 missense probably damaging 1.00
IGL01433:Atp8b1 APN 18 64573519 missense probably benign 0.00
IGL01525:Atp8b1 APN 18 64539252 nonsense probably null
IGL01645:Atp8b1 APN 18 64546113 missense probably benign 0.06
IGL02008:Atp8b1 APN 18 64538695 splice site probably benign
IGL02227:Atp8b1 APN 18 64562190 missense probably benign
IGL02231:Atp8b1 APN 18 64550384 missense possibly damaging 0.94
IGL02326:Atp8b1 APN 18 64538583 missense probably damaging 0.99
IGL02562:Atp8b1 APN 18 64581986 missense probably benign
IGL02929:Atp8b1 APN 18 64561662 missense possibly damaging 0.63
enchilada UTSW 18 64545989 critical splice donor site probably null
PIT4520001:Atp8b1 UTSW 18 64568180 missense probably benign 0.34
PIT4696001:Atp8b1 UTSW 18 64539270 missense possibly damaging 0.93
R0144:Atp8b1 UTSW 18 64571374 splice site probably benign
R0193:Atp8b1 UTSW 18 64561636 missense probably benign
R0277:Atp8b1 UTSW 18 64568252 missense possibly damaging 0.94
R0308:Atp8b1 UTSW 18 64545244 nonsense probably null
R0323:Atp8b1 UTSW 18 64568252 missense possibly damaging 0.94
R0403:Atp8b1 UTSW 18 64540310 missense probably damaging 1.00
R0601:Atp8b1 UTSW 18 64571653 splice site probably null
R0614:Atp8b1 UTSW 18 64533587 splice site probably benign
R0883:Atp8b1 UTSW 18 64564541 missense probably benign 0.44
R1077:Atp8b1 UTSW 18 64573262 nonsense probably null
R1292:Atp8b1 UTSW 18 64571021 missense probably damaging 0.99
R1494:Atp8b1 UTSW 18 64564526 missense probably damaging 1.00
R1522:Atp8b1 UTSW 18 64550432 missense probably benign 0.00
R1534:Atp8b1 UTSW 18 64545264 missense probably damaging 1.00
R1535:Atp8b1 UTSW 18 64545264 missense probably damaging 1.00
R1536:Atp8b1 UTSW 18 64545264 missense probably damaging 1.00
R1537:Atp8b1 UTSW 18 64545264 missense probably damaging 1.00
R1650:Atp8b1 UTSW 18 64571549 splice site probably benign
R1772:Atp8b1 UTSW 18 64573492 missense possibly damaging 0.88
R2016:Atp8b1 UTSW 18 64540334 missense probably damaging 1.00
R2017:Atp8b1 UTSW 18 64540334 missense probably damaging 1.00
R2043:Atp8b1 UTSW 18 64605200 missense possibly damaging 0.94
R2223:Atp8b1 UTSW 18 64564357 missense possibly damaging 0.88
R3052:Atp8b1 UTSW 18 64553108 missense probably benign 0.04
R3694:Atp8b1 UTSW 18 64533721 missense possibly damaging 0.81
R3738:Atp8b1 UTSW 18 64533729 splice site probably benign
R4211:Atp8b1 UTSW 18 64553047 missense probably damaging 1.00
R4362:Atp8b1 UTSW 18 64564537 missense probably damaging 1.00
R4560:Atp8b1 UTSW 18 64556879 nonsense probably null
R4560:Atp8b1 UTSW 18 64568247 missense probably benign 0.11
R4562:Atp8b1 UTSW 18 64556891 missense probably damaging 1.00
R4615:Atp8b1 UTSW 18 64553099 missense probably null
R4676:Atp8b1 UTSW 18 64538678 missense probably benign 0.01
R4738:Atp8b1 UTSW 18 64545180 missense probably benign 0.31
R4774:Atp8b1 UTSW 18 64533659 missense possibly damaging 0.49
R4808:Atp8b1 UTSW 18 64561711 missense probably benign 0.01
R4868:Atp8b1 UTSW 18 64551866 missense probably damaging 1.00
R5162:Atp8b1 UTSW 18 64561662 missense possibly damaging 0.63
R5289:Atp8b1 UTSW 18 64546087 missense possibly damaging 0.51
R5328:Atp8b1 UTSW 18 64531391 missense probably benign 0.00
R5400:Atp8b1 UTSW 18 64545989 critical splice donor site probably null
R5587:Atp8b1 UTSW 18 64539210 missense probably damaging 1.00
R5623:Atp8b1 UTSW 18 64546094 missense possibly damaging 0.85
R5651:Atp8b1 UTSW 18 64531382 missense probably benign 0.31
R5652:Atp8b1 UTSW 18 64531382 missense probably benign 0.31
R5653:Atp8b1 UTSW 18 64545197 missense probably damaging 1.00
R5667:Atp8b1 UTSW 18 64581923 missense probably damaging 1.00
R5689:Atp8b1 UTSW 18 64564537 missense probably damaging 1.00
R6008:Atp8b1 UTSW 18 64577616 missense probably damaging 1.00
R6315:Atp8b1 UTSW 18 64531479 missense probably damaging 0.97
R6850:Atp8b1 UTSW 18 64556852 missense possibly damaging 0.94
R7255:Atp8b1 UTSW 18 64556868 missense probably damaging 1.00
X0025:Atp8b1 UTSW 18 64571405 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACAGGCAATTAATATGCAAAGCC -3'
(R):5'- GTGTGTATAAGATCCAAATGCTAGG -3'

Sequencing Primer
(F):5'- AACCATCCGCTGTGAGATCTG -3'
(R):5'- TATACTACCATTCCTGGCCC -3'
Posted On2018-08-01