Incidental Mutation 'R6760:Pcdhb11'
ID531208
Institutional Source Beutler Lab
Gene Symbol Pcdhb11
Ensembl Gene ENSMUSG00000051486
Gene Nameprotocadherin beta 11
SynonymsPcdhb5E, PcdhbK
MMRRC Submission
Accession Numbers

Genbank: NM_053136.3; Ensembl: ENSMUST00000053073

Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R6760 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37421418-37425836 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 37421584 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053073] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000053073
SMART Domains Protein: ENSMUSP00000056148
Gene: ENSMUSG00000051486

DomainStartEndE-ValueType
CA 54 131 3.51e-1 SMART
CA 155 240 4.11e-21 SMART
CA 264 344 6.37e-27 SMART
CA 367 448 4.79e-22 SMART
CA 472 558 7.31e-27 SMART
CA 588 669 2.46e-10 SMART
Pfam:Cadherin_C_2 686 769 3.4e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.1032 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.8%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco1 C A 4: 40,180,210 C370* probably null Het
Akap2 T C 4: 57,856,026 W493R probably damaging Het
Akap6 C T 12: 53,139,778 S1325L probably damaging Het
Atp2a3 A G 11: 72,982,740 D813G probably damaging Het
Baz2b T A 2: 59,962,432 I451F probably benign Het
Calm2 T C 17: 87,435,695 D65G probably benign Het
Cdh23 C T 10: 60,306,168 V3049M probably damaging Het
Cfap46 A G 7: 139,652,440 L869P probably damaging Het
Chrna9 T A 5: 65,971,228 Y260N probably damaging Het
Clock G A 5: 76,226,976 P782L unknown Het
Coro2a A G 4: 46,540,572 M449T probably benign Het
Crispld1 T G 1: 17,750,801 V355G possibly damaging Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Gpr37 T C 6: 25,669,169 I559V probably benign Het
Grik5 A G 7: 25,058,939 probably null Het
Itga8 T C 2: 12,301,640 Y48C probably damaging Het
Manba T C 3: 135,542,451 V367A probably damaging Het
Mrgpra1 G A 7: 47,335,041 R297W probably benign Het
Myh7b C A 2: 155,620,118 Y311* probably null Het
Nmd3 T A 3: 69,746,837 probably null Het
Olfr1034 T A 2: 86,047,014 C177* probably null Het
Plcb1 C T 2: 135,472,060 T1144M possibly damaging Het
Sfrp1 A G 8: 23,411,888 D35G probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Timeless A G 10: 128,246,117 K537R probably benign Het
Tnrc6a T A 7: 123,171,999 V1004E probably damaging Het
Tubb4a T C 17: 57,080,796 E410G possibly damaging Het
U2surp G A 9: 95,493,711 A143V probably benign Het
Vmn2r118 T A 17: 55,592,714 H730L possibly damaging Het
Vmn2r28 G A 7: 5,481,230 T657I probably damaging Het
Ybey A T 10: 76,468,199 N56K probably benign Het
Other mutations in Pcdhb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Pcdhb11 APN 18 37421973 missense probably benign 0.00
IGL00906:Pcdhb11 APN 18 37422121 missense possibly damaging 0.67
IGL01610:Pcdhb11 APN 18 37423359 missense probably benign 0.00
IGL01973:Pcdhb11 APN 18 37423512 missense probably damaging 1.00
IGL01977:Pcdhb11 APN 18 37422291 missense possibly damaging 0.49
IGL02164:Pcdhb11 APN 18 37423359 missense probably benign 0.00
IGL02282:Pcdhb11 APN 18 37423828 missense probably damaging 1.00
IGL02674:Pcdhb11 APN 18 37423614 missense probably damaging 1.00
IGL02965:Pcdhb11 APN 18 37423968 missense probably benign
IGL03197:Pcdhb11 APN 18 37422424 nonsense probably null
1mM(1):Pcdhb11 UTSW 18 37423957 missense probably benign 0.00
R0001:Pcdhb11 UTSW 18 37423989 missense probably benign 0.06
R0383:Pcdhb11 UTSW 18 37423393 missense probably damaging 1.00
R0421:Pcdhb11 UTSW 18 37422480 missense probably benign 0.04
R0422:Pcdhb11 UTSW 18 37421870 missense probably damaging 1.00
R0427:Pcdhb11 UTSW 18 37422765 missense probably damaging 1.00
R0542:Pcdhb11 UTSW 18 37423834 missense probably damaging 1.00
R0620:Pcdhb11 UTSW 18 37421811 nonsense probably null
R1014:Pcdhb11 UTSW 18 37423369 missense probably damaging 1.00
R1277:Pcdhb11 UTSW 18 37421716 missense possibly damaging 0.79
R2034:Pcdhb11 UTSW 18 37422493 missense probably benign 0.00
R2142:Pcdhb11 UTSW 18 37422123 missense probably benign 0.28
R2496:Pcdhb11 UTSW 18 37422322 missense probably benign 0.30
R3077:Pcdhb11 UTSW 18 37422244 missense probably benign 0.08
R4560:Pcdhb11 UTSW 18 37423734 missense possibly damaging 0.61
R4590:Pcdhb11 UTSW 18 37422496 missense probably damaging 0.98
R4642:Pcdhb11 UTSW 18 37421968 missense probably benign 0.01
R4729:Pcdhb11 UTSW 18 37422366 nonsense probably null
R5012:Pcdhb11 UTSW 18 37422976 missense possibly damaging 0.48
R5364:Pcdhb11 UTSW 18 37422179 missense probably benign 0.06
R5910:Pcdhb11 UTSW 18 37423743 missense probably benign 0.43
R6023:Pcdhb11 UTSW 18 37422925 missense possibly damaging 0.94
R6106:Pcdhb11 UTSW 18 37423003 missense probably damaging 1.00
R6254:Pcdhb11 UTSW 18 37421718 missense probably damaging 0.99
R6276:Pcdhb11 UTSW 18 37421760 missense probably benign 0.36
R6360:Pcdhb11 UTSW 18 37422159 missense probably benign
R6699:Pcdhb11 UTSW 18 37422937 missense probably damaging 1.00
R6732:Pcdhb11 UTSW 18 37422144 missense probably benign
R6916:Pcdhb11 UTSW 18 37422381 missense possibly damaging 0.52
R7130:Pcdhb11 UTSW 18 37423506 missense probably benign 0.04
R7267:Pcdhb11 UTSW 18 37421953 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CAAATAAGGACACTTGGTGGCG -3'
(R):5'- ACGTTTGCCACCAAATAGCC -3'

Sequencing Primer
(F):5'- TGTCAAGAATGAGCTCTGCAGAC -3'
(R):5'- GTTTGCCACCAAATAGCCACTCTC -3'
Posted On2018-08-01