Incidental Mutation 'R6336:Kcnt1'
ID531247
Institutional Source Beutler Lab
Gene Symbol Kcnt1
Ensembl Gene ENSMUSG00000058740
Gene Namepotassium channel, subfamily T, member 1
SynonymsC030030G16Rik, Slack, slo2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.502) question?
Stock #R6336 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location25863734-25918273 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 25888755 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037580] [ENSMUST00000114172] [ENSMUST00000114176] [ENSMUST00000171268] [ENSMUST00000197917] [ENSMUST00000198204] [ENSMUST00000200434]
Predicted Effect probably null
Transcript: ENSMUST00000037580
SMART Domains Protein: ENSMUSP00000039058
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 252 335 1.3e-12 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 477 579 5.8e-32 PFAM
PDB:3U6N|H 794 983 6e-6 PDB
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1212 1229 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114172
SMART Domains Protein: ENSMUSP00000109809
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.2e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.3e-38 PFAM
PDB:3U6N|H 792 981 7e-6 PDB
low complexity region 1057 1074 N/A INTRINSIC
low complexity region 1210 1227 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114176
SMART Domains Protein: ENSMUSP00000109813
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.1e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.2e-38 PFAM
PDB:3U6N|H 794 983 6e-6 PDB
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171268
SMART Domains Protein: ENSMUSP00000132212
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
transmembrane domain 78 97 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:Ion_trans_2 235 315 5.1e-13 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Pfam:BK_channel_a 455 560 3.2e-38 PFAM
PDB:3U6N|H 774 963 7e-6 PDB
low complexity region 1039 1056 N/A INTRINSIC
low complexity region 1192 1209 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000197917
SMART Domains Protein: ENSMUSP00000143106
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.2e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.3e-38 PFAM
PDB:3U6N|H 792 981 7e-6 PDB
low complexity region 1057 1074 N/A INTRINSIC
low complexity region 1210 1227 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000198204
SMART Domains Protein: ENSMUSP00000142870
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
Pfam:Ion_trans_2 221 301 5e-11 PFAM
transmembrane domain 321 343 N/A INTRINSIC
Pfam:BK_channel_a 441 546 1.2e-35 PFAM
PDB:3U6N|H 760 949 6e-6 PDB
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1157 1174 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000200434
SMART Domains Protein: ENSMUSP00000143482
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
Pfam:Ion_trans_2 221 301 5.1e-11 PFAM
transmembrane domain 321 343 N/A INTRINSIC
Pfam:BK_channel_a 441 546 1.3e-35 PFAM
PDB:3U6N|H 758 947 6e-6 PDB
low complexity region 1023 1040 N/A INTRINSIC
low complexity region 1176 1193 N/A INTRINSIC
Meta Mutation Damage Score 0.6304 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: This gene encodes a member of the Slo potassium channel family that has shown to be activated by both sodium and chloride ions. This channel represents the largest potassium channel subunit yet identified. This channel may be important in development and pain signaling. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired action potential firing in sensory neurons and increased mechanical hypersensitivity in neuropathic pain models. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,183,483 P955Q possibly damaging Het
Adgrv1 T C 13: 81,385,981 N5827S probably benign Het
Akt3 T C 1: 177,031,712 D431G probably damaging Het
Anapc16 A T 10: 59,988,829 V76D possibly damaging Het
Ankib1 A T 5: 3,700,377 Y755* probably null Het
Ankrd6 A G 4: 32,860,411 S11P probably damaging Het
Card6 T A 15: 5,099,164 K917* probably null Het
Ccdc152 T C 15: 3,301,129 I21M probably damaging Het
Ccdc40 A G 11: 119,231,993 E207G possibly damaging Het
Clca3a2 G T 3: 144,806,478 A499E probably benign Het
Cntnap5b C T 1: 100,358,669 A383V probably benign Het
Ddo T C 10: 40,633,031 V89A probably damaging Het
Depdc5 T C 5: 32,964,507 probably null Het
Dlgap1 T A 17: 70,815,289 D904E probably damaging Het
Ephb4 T A 5: 137,372,085 L849H probably damaging Het
Fbxl13 A G 5: 21,523,547 probably null Het
Fer1l6 C A 15: 58,559,232 Y245* probably null Het
Foxred2 A G 15: 77,955,764 Y109H probably damaging Het
Gabarapl1 A G 6: 129,537,528 D43G probably benign Het
Gabrb1 A C 5: 72,029,898 E178A possibly damaging Het
Gbp11 A G 5: 105,325,489 Het
Gm31371 A G 8: 19,924,350 K242E unknown Het
Grin3b C A 10: 79,976,461 A845E probably damaging Het
Hoxd4 A G 2: 74,727,361 Y28C probably damaging Het
Igsf10 G A 3: 59,330,339 T807M probably benign Het
Kdm5a C A 6: 120,398,978 T565K probably damaging Het
Map7d1 A G 4: 126,236,682 S412P probably damaging Het
Mok A G 12: 110,834,124 probably null Het
Mto1 A T 9: 78,473,835 I73F probably damaging Het
Mtss1l G A 8: 110,732,164 D310N probably damaging Het
Ncf2 T C 1: 152,834,070 Y393H probably damaging Het
Olfr1299 A G 2: 111,664,619 H131R possibly damaging Het
Olfr1317 A C 2: 112,142,406 I154L probably benign Het
Olfr1384 G T 11: 49,514,542 K301N probably damaging Het
Olfr272 A T 4: 52,911,459 C112S probably damaging Het
Olfr38 T C 6: 42,762,657 S202P probably damaging Het
Olfr67 T C 7: 103,788,245 T11A possibly damaging Het
Phxr2 T A 10: 99,126,090 probably benign Het
Rnf17 A G 14: 56,421,169 probably null Het
Serpinb9d T C 13: 33,194,694 M41T probably damaging Het
Slc12a5 T A 2: 164,992,464 probably null Het
Slc22a6 G A 19: 8,622,130 R331H probably benign Het
Spg11 G C 2: 122,112,959 probably null Het
Src T A 2: 157,457,155 V24E probably benign Het
Srgap1 A T 10: 121,925,941 Y101N probably benign Het
Vmn2r30 T A 7: 7,334,308 T110S probably benign Het
Vwa3a A G 7: 120,762,423 E119G possibly damaging Het
Whamm T A 7: 81,591,764 D274E probably damaging Het
Other mutations in Kcnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Kcnt1 APN 2 25892407 missense probably damaging 0.98
IGL01358:Kcnt1 APN 2 25916005 missense probably damaging 1.00
IGL01593:Kcnt1 APN 2 25898754 missense probably damaging 1.00
IGL01779:Kcnt1 APN 2 25900967 missense probably damaging 1.00
IGL01800:Kcnt1 APN 2 25888125 missense probably damaging 1.00
IGL01834:Kcnt1 APN 2 25912719 critical splice donor site probably null
IGL02001:Kcnt1 APN 2 25908152 missense probably damaging 1.00
IGL02061:Kcnt1 APN 2 25900482 critical splice donor site probably null
IGL02121:Kcnt1 APN 2 25901865 missense probably damaging 1.00
IGL02646:Kcnt1 APN 2 25900880 splice site probably benign
IGL02683:Kcnt1 APN 2 25900925 missense possibly damaging 0.85
IGL03028:Kcnt1 APN 2 25909203 critical splice acceptor site probably null
IGL03139:Kcnt1 APN 2 25894468 splice site probably benign
R0070:Kcnt1 UTSW 2 25892362 missense probably benign 0.00
R0070:Kcnt1 UTSW 2 25892362 missense probably benign 0.00
R0149:Kcnt1 UTSW 2 25898264 splice site probably benign
R0294:Kcnt1 UTSW 2 25888110 missense probably damaging 0.99
R0367:Kcnt1 UTSW 2 25907628 missense probably damaging 1.00
R0481:Kcnt1 UTSW 2 25892496 missense probably damaging 0.98
R0666:Kcnt1 UTSW 2 25891243 splice site probably benign
R1364:Kcnt1 UTSW 2 25908094 missense probably damaging 0.99
R1553:Kcnt1 UTSW 2 25900385 missense probably damaging 1.00
R1916:Kcnt1 UTSW 2 25900469 missense probably damaging 1.00
R1999:Kcnt1 UTSW 2 25892360 missense probably benign
R2079:Kcnt1 UTSW 2 25900248 missense possibly damaging 0.48
R2166:Kcnt1 UTSW 2 25891183 splice site probably benign
R2295:Kcnt1 UTSW 2 25900921 missense probably damaging 1.00
R3688:Kcnt1 UTSW 2 25894359 missense probably damaging 1.00
R3820:Kcnt1 UTSW 2 25900892 missense probably damaging 1.00
R3826:Kcnt1 UTSW 2 25915868 critical splice donor site probably null
R3980:Kcnt1 UTSW 2 25893214 missense possibly damaging 0.91
R4031:Kcnt1 UTSW 2 25916048 missense possibly damaging 0.77
R4093:Kcnt1 UTSW 2 25877915 missense probably damaging 0.99
R4361:Kcnt1 UTSW 2 25878032 missense probably benign 0.03
R4367:Kcnt1 UTSW 2 25907626 missense probably damaging 1.00
R4850:Kcnt1 UTSW 2 25908100 missense probably damaging 1.00
R5005:Kcnt1 UTSW 2 25901346 missense probably damaging 1.00
R5119:Kcnt1 UTSW 2 25909322 intron probably benign
R5223:Kcnt1 UTSW 2 25903422 missense probably benign
R5243:Kcnt1 UTSW 2 25908074 missense probably damaging 1.00
R5323:Kcnt1 UTSW 2 25909277 missense possibly damaging 0.59
R5665:Kcnt1 UTSW 2 25901909 nonsense probably null
R5888:Kcnt1 UTSW 2 25908110 missense probably damaging 1.00
R5906:Kcnt1 UTSW 2 25894524 intron probably benign
R5906:Kcnt1 UTSW 2 25898401 missense probably damaging 1.00
R5927:Kcnt1 UTSW 2 25909376 intron probably benign
R6160:Kcnt1 UTSW 2 25892383 missense probably damaging 0.96
R6161:Kcnt1 UTSW 2 25903385 missense probably benign 0.00
R6179:Kcnt1 UTSW 2 25893180 missense probably damaging 1.00
R6222:Kcnt1 UTSW 2 25892510 missense probably damaging 1.00
R6268:Kcnt1 UTSW 2 25903597 splice site probably null
R6395:Kcnt1 UTSW 2 25909239 missense possibly damaging 0.81
R6564:Kcnt1 UTSW 2 25911051 missense probably benign 0.09
R6944:Kcnt1 UTSW 2 25877828 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGAAGTGGCCTTGGGAAATC -3'
(R):5'- ATGCCAGTGGAACGCAATGG -3'

Sequencing Primer
(F):5'- AAGCCTCTGCACTGTAAGTCTCAG -3'
(R):5'- CGCAATGGAAAGGCTCAGC -3'
Posted On2018-08-17