Incidental Mutation 'R6336:Rnf17'
ID531251
Institutional Source Beutler Lab
Gene Symbol Rnf17
Ensembl Gene ENSMUSG00000000365
Gene Namering finger protein 17
SynonymsMMIP-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.583) question?
Stock #R6336 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location56402581-56525032 bp(+) (GRCm38)
Type of Mutationunclassified (3 bp from exon)
DNA Base Change (assembly) A to G at 56421169 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095793] [ENSMUST00000223627]
Predicted Effect probably null
Transcript: ENSMUST00000095793
SMART Domains Protein: ENSMUSP00000093469
Gene: ENSMUSG00000000365

DomainStartEndE-ValueType
Blast:RING 9 72 2e-15 BLAST
low complexity region 398 405 N/A INTRINSIC
Pfam:TUDOR 440 522 8.2e-8 PFAM
TUDOR 750 807 4.32e-12 SMART
low complexity region 824 836 N/A INTRINSIC
Blast:TUDOR 850 882 1e-8 BLAST
low complexity region 959 970 N/A INTRINSIC
TUDOR 984 1042 1.29e-1 SMART
low complexity region 1128 1139 N/A INTRINSIC
TUDOR 1245 1301 7.7e-9 SMART
low complexity region 1416 1430 N/A INTRINSIC
TUDOR 1495 1554 1e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000223627
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a testis-specific protein containing a RING finger domain. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display male infertility, azoospermia, arrest of spermatogenesis, and small testis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,183,483 P955Q possibly damaging Het
Adgrv1 T C 13: 81,385,981 N5827S probably benign Het
Akt3 T C 1: 177,031,712 D431G probably damaging Het
Anapc16 A T 10: 59,988,829 V76D possibly damaging Het
Ankib1 A T 5: 3,700,377 Y755* probably null Het
Ankrd6 A G 4: 32,860,411 S11P probably damaging Het
Card6 T A 15: 5,099,164 K917* probably null Het
Ccdc152 T C 15: 3,301,129 I21M probably damaging Het
Ccdc40 A G 11: 119,231,993 E207G possibly damaging Het
Clca3a2 G T 3: 144,806,478 A499E probably benign Het
Cntnap5b C T 1: 100,358,669 A383V probably benign Het
Ddo T C 10: 40,633,031 V89A probably damaging Het
Depdc5 T C 5: 32,964,507 probably null Het
Dlgap1 T A 17: 70,815,289 D904E probably damaging Het
Ephb4 T A 5: 137,372,085 L849H probably damaging Het
Fbxl13 A G 5: 21,523,547 probably null Het
Fer1l6 C A 15: 58,559,232 Y245* probably null Het
Foxred2 A G 15: 77,955,764 Y109H probably damaging Het
Gabarapl1 A G 6: 129,537,528 D43G probably benign Het
Gabrb1 A C 5: 72,029,898 E178A possibly damaging Het
Gbp11 A G 5: 105,325,489 Het
Gm31371 A G 8: 19,924,350 K242E unknown Het
Grin3b C A 10: 79,976,461 A845E probably damaging Het
Hoxd4 A G 2: 74,727,361 Y28C probably damaging Het
Igsf10 G A 3: 59,330,339 T807M probably benign Het
Kcnt1 A G 2: 25,888,755 probably null Het
Kdm5a C A 6: 120,398,978 T565K probably damaging Het
Map7d1 A G 4: 126,236,682 S412P probably damaging Het
Mok A G 12: 110,834,124 probably null Het
Mto1 A T 9: 78,473,835 I73F probably damaging Het
Mtss1l G A 8: 110,732,164 D310N probably damaging Het
Ncf2 T C 1: 152,834,070 Y393H probably damaging Het
Olfr1299 A G 2: 111,664,619 H131R possibly damaging Het
Olfr1317 A C 2: 112,142,406 I154L probably benign Het
Olfr1384 G T 11: 49,514,542 K301N probably damaging Het
Olfr272 A T 4: 52,911,459 C112S probably damaging Het
Olfr38 T C 6: 42,762,657 S202P probably damaging Het
Olfr67 T C 7: 103,788,245 T11A possibly damaging Het
Phxr2 T A 10: 99,126,090 probably benign Het
Serpinb9d T C 13: 33,194,694 M41T probably damaging Het
Slc12a5 T A 2: 164,992,464 probably null Het
Slc22a6 G A 19: 8,622,130 R331H probably benign Het
Spg11 G C 2: 122,112,959 probably null Het
Src T A 2: 157,457,155 V24E probably benign Het
Srgap1 A T 10: 121,925,941 Y101N probably benign Het
Vmn2r30 T A 7: 7,334,308 T110S probably benign Het
Vwa3a A G 7: 120,762,423 E119G possibly damaging Het
Whamm T A 7: 81,591,764 D274E probably damaging Het
Other mutations in Rnf17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Rnf17 APN 14 56421082 missense probably damaging 0.99
IGL00717:Rnf17 APN 14 56465750 missense probably benign 0.00
IGL00978:Rnf17 APN 14 56512271 missense probably damaging 1.00
IGL01295:Rnf17 APN 14 56463064 nonsense probably null
IGL01779:Rnf17 APN 14 56462063 missense probably benign 0.06
IGL02132:Rnf17 APN 14 56421166 missense probably benign 0.27
IGL02183:Rnf17 APN 14 56507868 missense probably null 0.99
IGL02387:Rnf17 APN 14 56500587 missense probably damaging 1.00
IGL02422:Rnf17 APN 14 56482135 missense probably damaging 1.00
IGL03081:Rnf17 APN 14 56434371 missense probably benign 0.03
IGL03269:Rnf17 APN 14 56427946 missense possibly damaging 0.74
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0089:Rnf17 UTSW 14 56514106 missense probably damaging 1.00
R0189:Rnf17 UTSW 14 56482193 missense probably null 1.00
R0243:Rnf17 UTSW 14 56482084 missense possibly damaging 0.80
R0245:Rnf17 UTSW 14 56438609 missense probably damaging 0.97
R0486:Rnf17 UTSW 14 56514175 missense probably benign 0.43
R0554:Rnf17 UTSW 14 56522550 missense probably damaging 1.00
R0840:Rnf17 UTSW 14 56475447 missense probably damaging 1.00
R1169:Rnf17 UTSW 14 56514165 missense possibly damaging 0.89
R1170:Rnf17 UTSW 14 56425631 missense probably benign 0.10
R1200:Rnf17 UTSW 14 56467706 missense probably benign 0.44
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1472:Rnf17 UTSW 14 56427979 missense probably damaging 1.00
R1512:Rnf17 UTSW 14 56467786 missense probably benign 0.01
R1605:Rnf17 UTSW 14 56493365 missense probably damaging 1.00
R1778:Rnf17 UTSW 14 56522399 missense probably damaging 0.99
R1791:Rnf17 UTSW 14 56504007 nonsense probably null
R2015:Rnf17 UTSW 14 56486969 missense probably benign 0.00
R2023:Rnf17 UTSW 14 56431579 missense possibly damaging 0.59
R2086:Rnf17 UTSW 14 56483380 missense probably damaging 0.98
R2130:Rnf17 UTSW 14 56493354 missense probably damaging 1.00
R2309:Rnf17 UTSW 14 56505982 missense possibly damaging 0.95
R3003:Rnf17 UTSW 14 56500547 missense probably damaging 1.00
R3611:Rnf17 UTSW 14 56467740 missense probably benign 0.43
R3847:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3848:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3849:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3850:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3872:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R3874:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R4021:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4022:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4790:Rnf17 UTSW 14 56434355 missense probably damaging 1.00
R4951:Rnf17 UTSW 14 56522391 missense probably benign 0.02
R5068:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5069:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5070:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5518:Rnf17 UTSW 14 56482133 missense probably damaging 1.00
R5628:Rnf17 UTSW 14 56486952 splice site probably null
R5712:Rnf17 UTSW 14 56471399 missense probably benign 0.19
R5747:Rnf17 UTSW 14 56465819 critical splice donor site probably null
R5869:Rnf17 UTSW 14 56505988 missense possibly damaging 0.94
R6626:Rnf17 UTSW 14 56427924 missense possibly damaging 0.92
R6639:Rnf17 UTSW 14 56438743 missense probably benign 0.01
R6675:Rnf17 UTSW 14 56459975 missense probably damaging 1.00
R6731:Rnf17 UTSW 14 56524350 missense possibly damaging 0.93
R7062:Rnf17 UTSW 14 56465654 missense probably benign 0.00
R7103:Rnf17 UTSW 14 56471306 missense not run
Predicted Primers PCR Primer
(F):5'- CCCTTGACTTGGAGAGTTTTAGAATC -3'
(R):5'- TTCTCAGCCTCCTGTTGGAAG -3'

Sequencing Primer
(F):5'- ACCTGTTCCTTTTTATGAAGAGC -3'
(R):5'- CAGCCTCCTGTTGGAAGGTTTTC -3'
Posted On2018-08-17