Incidental Mutation 'R6299:Gm10549'
ID531264
Institutional Source Beutler Lab
Gene Symbol Gm10549
Ensembl Gene ENSMUSG00000073610
Gene Namepredicted gene 10549
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R6299 (G1)
Quality Score74.0075
Status Validated
Chromosome18
Chromosomal Location33464163-33472448 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 33464305 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051087] [ENSMUST00000097634] [ENSMUST00000168890] [ENSMUST00000171533]
Predicted Effect probably benign
Transcript: ENSMUST00000051087
SMART Domains Protein: ENSMUSP00000058132
Gene: ENSMUSG00000042834

DomainStartEndE-ValueType
Pfam:Alveol-reg_P311 1 68 2.6e-41 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000097634
AA Change: A48D
SMART Domains Protein: ENSMUSP00000095236
Gene: ENSMUSG00000073610
AA Change: A48D

DomainStartEndE-ValueType
low complexity region 56 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168890
SMART Domains Protein: ENSMUSP00000130297
Gene: ENSMUSG00000042834

DomainStartEndE-ValueType
Pfam:Alveol-reg_P311 1 68 2.6e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171533
SMART Domains Protein: ENSMUSP00000127787
Gene: ENSMUSG00000042834

DomainStartEndE-ValueType
Pfam:Alveol-reg_P311 1 68 2.6e-41 PFAM
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bms1 G A 6: 118,418,515 R24W probably damaging Het
C130050O18Rik A T 5: 139,414,371 S60C probably damaging Het
Cabcoco1 A G 10: 68,436,890 Y222H probably damaging Het
Cc2d1b T C 4: 108,628,138 V559A probably benign Het
Cgrrf1 T A 14: 46,840,190 N46K probably damaging Het
Clca3a1 T C 3: 144,758,514 D114G probably damaging Het
Clcnkb T A 4: 141,410,723 L279F probably damaging Het
Cr2 T C 1: 195,168,646 T151A probably damaging Het
Creb3l3 C T 10: 81,088,613 E236K probably damaging Het
Dcstamp T A 15: 39,755,203 V336D probably damaging Het
Dopey1 T G 9: 86,504,212 F379V probably damaging Het
Esf1 T C 2: 140,123,634 K714R possibly damaging Het
Exoc3l4 A T 12: 111,422,079 M1L possibly damaging Het
Extl3 T C 14: 65,076,672 R354G probably benign Het
Fastkd3 T C 13: 68,587,736 L535P probably damaging Het
Gab2 A G 7: 97,081,859 T12A probably benign Het
Golga4 T A 9: 118,557,370 S1187T probably benign Het
Haus3 A G 5: 34,167,796 V173A probably benign Het
Herc2 T A 7: 56,135,055 Y1416N possibly damaging Het
Hspg2 A G 4: 137,544,705 Y2566C probably damaging Het
Inpp5f A T 7: 128,636,160 T34S possibly damaging Het
Iqck G A 7: 118,876,262 G70S unknown Het
Jade1 T C 3: 41,613,725 F743L probably damaging Het
Kif5a T C 10: 127,233,821 K845R probably damaging Het
Klhl30 A G 1: 91,357,914 probably null Het
Map2k1 T C 9: 64,214,490 D67G possibly damaging Het
Mcm9 A C 10: 53,537,681 C434W probably damaging Het
Muc4 T G 16: 32,752,035 S638A possibly damaging Het
Nectin3 A G 16: 46,463,982 V113A probably damaging Het
Nfya T C 17: 48,392,910 probably benign Het
Nup155 G T 15: 8,128,438 A460S possibly damaging Het
Nup210 T C 6: 91,074,288 E371G possibly damaging Het
Olfm3 T C 3: 115,120,983 S228P probably damaging Het
Olfr659 C A 7: 104,670,868 D55E probably benign Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Plin1 A C 7: 79,721,476 V500G probably benign Het
Ppfia1 A C 7: 144,510,312 M513R probably benign Het
Ppp1cb T A 5: 32,483,454 C27* probably null Het
Prss22 T A 17: 23,996,434 I123F probably damaging Het
Rbm24 G T 13: 46,419,073 V15L probably damaging Het
Reln T C 5: 22,286,944 T97A possibly damaging Het
Sipa1l2 T C 8: 125,453,464 T1065A possibly damaging Het
Sipa1l3 A C 7: 29,366,549 probably null Het
Snrnp200 T A 2: 127,222,161 Y689* probably null Het
Srcap T C 7: 127,530,454 probably benign Het
Sv2a T C 3: 96,188,249 probably null Het
Tcf12 A T 9: 71,858,929 V474D probably damaging Het
Tpcn2 A T 7: 145,262,243 S403T probably damaging Het
Trim65 C A 11: 116,126,551 A362S probably benign Het
Trmt1 T A 8: 84,697,290 C36* probably null Het
Trpm8 T A 1: 88,354,479 L699Q probably damaging Het
Ube2m A C 7: 13,035,870 I116R probably damaging Het
Ulk1 T C 5: 110,791,097 K492E possibly damaging Het
Usp40 T A 1: 87,997,927 K193N probably damaging Het
Vmn1r3 A G 4: 3,185,098 S70P possibly damaging Het
Vmn2r2 T A 3: 64,116,653 K836* probably null Het
Vmn2r75 T A 7: 86,165,274 H337L probably benign Het
Wars G A 12: 108,861,383 T437M probably benign Het
Zdhhc5 T C 2: 84,690,481 T451A probably benign Het
Zfp788 T G 7: 41,648,541 H180Q possibly damaging Het
Zkscan7 A G 9: 122,888,717 E59G probably damaging Het
Other mutations in Gm10549
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02648:Gm10549 APN 18 33464250 unclassified probably benign
R0374:Gm10549 UTSW 18 33464182 unclassified probably benign
R0668:Gm10549 UTSW 18 33470850 missense unknown
R1806:Gm10549 UTSW 18 33470788 missense unknown
R4214:Gm10549 UTSW 18 33464477 splice site probably null
R4826:Gm10549 UTSW 18 33470785 missense unknown
R5747:Gm10549 UTSW 18 33464305 unclassified probably benign
R5748:Gm10549 UTSW 18 33464305 unclassified probably benign
R5766:Gm10549 UTSW 18 33464305 unclassified probably benign
R5796:Gm10549 UTSW 18 33464305 unclassified probably benign
R6101:Gm10549 UTSW 18 33464305 unclassified probably benign
R6129:Gm10549 UTSW 18 33464305 unclassified probably benign
R6130:Gm10549 UTSW 18 33464305 unclassified probably benign
R6218:Gm10549 UTSW 18 33464305 unclassified probably benign
R6219:Gm10549 UTSW 18 33464305 unclassified probably benign
R6220:Gm10549 UTSW 18 33464305 unclassified probably benign
R6283:Gm10549 UTSW 18 33464305 unclassified probably benign
R6298:Gm10549 UTSW 18 33464305 unclassified probably benign
R6309:Gm10549 UTSW 18 33464305 unclassified probably benign
R6321:Gm10549 UTSW 18 33464305 unclassified probably benign
R6322:Gm10549 UTSW 18 33464305 unclassified probably benign
R6327:Gm10549 UTSW 18 33464305 unclassified probably benign
R6337:Gm10549 UTSW 18 33464305 unclassified probably benign
R6405:Gm10549 UTSW 18 33464305 unclassified probably benign
R6420:Gm10549 UTSW 18 33464305 unclassified probably benign
R6492:Gm10549 UTSW 18 33464305 unclassified probably benign
R6494:Gm10549 UTSW 18 33464305 unclassified probably benign
R6505:Gm10549 UTSW 18 33464305 unclassified probably benign
R7173:Gm10549 UTSW 18 33464409 missense unknown
Predicted Primers PCR Primer
(F):5'- AATAATAAACCTGCGGCCGGG -3'
(R):5'- GGGCTGAGAACTTTGAAAGC -3'

Sequencing Primer
(F):5'- CGGGGCATCTGAGGGAAC -3'
(R):5'- TAGCGTCTCCGGTTGCAC -3'
Posted On2018-08-21