Mutagenetix > Incidental Mutation

Incidental Mutation 'R6776:Chd3'

531306

Institutional Source

Beutler Lab

Gene Symbol

Chd3

Ensembl Gene

ENSMUSG00000018474

Gene Name

chromodomain helicase DNA binding protein 3

Synonyms

2600010P09Rik, Mi-2 alpha, Chd7, Prp7, Prp9-1

MMRRC Submission

044892-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6776 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

69234099-69260232 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 69245296 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Valine at position 1141 (L1141V)

Ref Sequence

ENSEMBL: ENSMUSP00000104301 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092971] [ENSMUST00000108661]

AlphaFold

B1AR17

Predicted Effect

probably damaging
Transcript: ENSMUST00000092971
AA Change: L1141V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000090649
Gene: ENSMUSG00000018474
AA Change: L1141V

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	100	114	N/A	INTRINSIC
low complexity region	148	180	N/A	INTRINSIC
Pfam:CHDNT	199	253	1.4e-34	PFAM
low complexity region	257	283	N/A	INTRINSIC
low complexity region	285	308	N/A	INTRINSIC
low complexity region	345	360	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	398	414	N/A	INTRINSIC
PHD	434	477	1.54e-14	SMART
RING	435	476	4.25e-1	SMART
PHD	510	553	1.74e-13	SMART
RING	511	552	3.93e0	SMART
CHROMO	558	637	7.23e-14	SMART
CHROMO	681	730	2.85e-12	SMART
low complexity region	749	755	N/A	INTRINSIC
DEXDc	784	996	1.64e-31	SMART
low complexity region	1107	1125	N/A	INTRINSIC
HELICc	1142	1226	2.61e-25	SMART
low complexity region	1290	1303	N/A	INTRINSIC
DUF1087	1345	1409	2.98e-33	SMART
DUF1086	1415	1571	1.79e-109	SMART
low complexity region	1573	1602	N/A	INTRINSIC
low complexity region	1672	1685	N/A	INTRINSIC
Pfam:CHDCT2	1754	1926	8.6e-104	PFAM
low complexity region	1935	1967	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108661
AA Change: L1141V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104301
Gene: ENSMUSG00000018474
AA Change: L1141V

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	100	114	N/A	INTRINSIC
low complexity region	148	180	N/A	INTRINSIC
Pfam:CHDNT	200	253	4.3e-29	PFAM
low complexity region	257	283	N/A	INTRINSIC
low complexity region	285	308	N/A	INTRINSIC
low complexity region	345	360	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	398	414	N/A	INTRINSIC
PHD	434	477	1.54e-14	SMART
RING	435	476	4.25e-1	SMART
PHD	510	553	1.74e-13	SMART
RING	511	552	3.93e0	SMART
CHROMO	558	637	7.23e-14	SMART
CHROMO	681	730	2.85e-12	SMART
low complexity region	749	755	N/A	INTRINSIC
DEXDc	784	996	1.64e-31	SMART
low complexity region	1107	1125	N/A	INTRINSIC
HELICc	1142	1226	2.61e-25	SMART
low complexity region	1290	1303	N/A	INTRINSIC
DUF1087	1345	1409	2.98e-33	SMART
DUF1086	1415	1571	1.79e-109	SMART
low complexity region	1573	1602	N/A	INTRINSIC
low complexity region	1672	1685	N/A	INTRINSIC
Pfam:CHDCT2	1789	1960	4.9e-93	PFAM
low complexity region	1969	2001	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000128981
AA Change: L1047V

SMART Domains

Protein: ENSMUSP00000122137
Gene: ENSMUSG00000018474
AA Change: L1047V

Domain	Start	End	E-Value	Type
low complexity region	7	21	N/A	INTRINSIC
low complexity region	55	87	N/A	INTRINSIC
Pfam:CHDNT	107	160	3.9e-29	PFAM
low complexity region	164	190	N/A	INTRINSIC
low complexity region	192	215	N/A	INTRINSIC
low complexity region	252	267	N/A	INTRINSIC
low complexity region	274	283	N/A	INTRINSIC
low complexity region	305	321	N/A	INTRINSIC
PHD	341	384	1.54e-14	SMART
RING	342	383	4.25e-1	SMART
PHD	417	460	1.74e-13	SMART
RING	418	459	3.93e0	SMART
CHROMO	465	544	7.23e-14	SMART
CHROMO	588	637	2.85e-12	SMART
low complexity region	656	662	N/A	INTRINSIC
DEXDc	691	903	1.64e-31	SMART
low complexity region	1014	1032	N/A	INTRINSIC
HELICc	1049	1133	2.61e-25	SMART
low complexity region	1197	1210	N/A	INTRINSIC
DUF1087	1252	1316	2.98e-33	SMART
DUF1086	1322	1478	1.79e-109	SMART
low complexity region	1480	1509	N/A	INTRINSIC
low complexity region	1579	1592	N/A	INTRINSIC
Pfam:CHDCT2	1662	1833	4.4e-93	PFAM
low complexity region	1842	1874	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000151436
AA Change: L195V

SMART Domains

Protein: ENSMUSP00000118172
Gene: ENSMUSG00000018474
AA Change: L195V

Domain	Start	End	E-Value	Type
Pfam:SNF2_N	1	142	9e-24	PFAM
SCOP:d1gkub2	162	197	1e-3	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CHD family of proteins which are characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. This protein is one of the components of a histone deacetylase complex referred to as the Mi-2/NuRD complex which participates in the remodeling of chromatin by deacetylating histones. Chromatin remodeling is essential for many processes including transcription. Autoantibodies against this protein are found in a subset of patients with dermatomyositis. Three alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd13	A	G	8: 10,038,075 (GRCm39)	H224R	probably benign	Het
Anapc10	T	C	8: 80,446,374 (GRCm39)	F68S	probably damaging	Het
Arid2	A	G	15: 96,268,830 (GRCm39)	N981S	probably benign	Het
Bmerb1	T	A	16: 13,804,670 (GRCm39)	S6T	possibly damaging	Het
Cfap73	A	G	5: 120,772,276 (GRCm39)	F9L	probably damaging	Het
Daam1	C	T	12: 72,036,582 (GRCm39)	L1052F	possibly damaging	Het
Dmxl1	C	T	18: 50,027,041 (GRCm39)	R2050C	probably damaging	Het
Dpp10	G	A	1: 123,295,385 (GRCm39)	Q552*	probably null	Het
Dysf	A	G	6: 84,041,876 (GRCm39)	D160G	possibly damaging	Het
Ecrg4	C	A	1: 43,781,551 (GRCm39)	N144K	probably damaging	Het
Firrm	T	C	1: 163,804,318 (GRCm39)	I338M	probably damaging	Het
Foxp1	TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG	TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG	6: 99,052,926 (GRCm39)		probably benign	Het
Ftcd	T	C	10: 76,425,073 (GRCm39)	I518T	probably benign	Het
Gapdh	A	G	6: 125,139,236 (GRCm39)	S248P	probably damaging	Het
Gm5592	C	G	7: 40,939,153 (GRCm39)	P812A	probably damaging	Het
Grik2	G	A	10: 49,232,085 (GRCm39)	L482F	probably damaging	Het
Gzmg	C	T	14: 56,394,288 (GRCm39)	G202D	probably damaging	Het
Hectd4	G	A	5: 121,491,574 (GRCm39)	A3671T	possibly damaging	Het
Hexa	G	T	9: 59,465,355 (GRCm39)	W203C	probably damaging	Het
Igdcc4	A	T	9: 65,042,700 (GRCm39)	T1217S	probably benign	Het
Ipo7	A	G	7: 109,646,272 (GRCm39)	D557G	probably damaging	Het
Irx3	T	A	8: 92,526,463 (GRCm39)	T414S	probably benign	Het
Jakmip1	G	A	5: 37,344,498 (GRCm39)	E1313K	probably damaging	Het
Kbtbd12	T	C	6: 88,595,248 (GRCm39)	D194G	probably damaging	Het
Klk6	T	C	7: 43,476,298 (GRCm39)	L46P	probably damaging	Het
Krt86	T	C	15: 101,374,817 (GRCm39)	I329T	probably benign	Het
Mroh5	A	G	15: 73,661,817 (GRCm39)		probably null	Het
Mtrf1	T	C	14: 79,650,521 (GRCm39)	V323A	probably damaging	Het
Oas3	A	T	5: 120,896,939 (GRCm39)	I894N	probably damaging	Het
Oplah	C	T	15: 76,185,053 (GRCm39)	V887I	possibly damaging	Het
Pag1	T	C	3: 9,764,848 (GRCm39)	T102A	probably benign	Het
Pcnx1	C	T	12: 82,009,496 (GRCm39)	A1181V	possibly damaging	Het
Pkdrej	G	T	15: 85,701,510 (GRCm39)	Y1475*	probably null	Het
Pla2g5	A	G	4: 138,527,964 (GRCm39)	S101P	probably benign	Het
Plekha4	C	A	7: 45,184,241 (GRCm39)	A76E	probably damaging	Het
Plk2	T	C	13: 110,536,325 (GRCm39)	I592T	probably benign	Het
Ppp2r3c	T	A	12: 55,345,252 (GRCm39)	R79*	probably null	Het
Ppp2r3d	A	T	9: 101,090,061 (GRCm39)	H87Q	probably benign	Het
Prpf40b	C	T	15: 99,212,784 (GRCm39)	R627W	probably damaging	Het
Prrt4	G	T	6: 29,176,551 (GRCm39)	T258K	possibly damaging	Het
Rhpn2	T	A	7: 35,083,194 (GRCm39)		probably null	Het
Slc11a1	T	A	1: 74,423,244 (GRCm39)	I365N	probably damaging	Het
Slc7a7	C	T	14: 54,612,108 (GRCm39)	G265D	possibly damaging	Het
Thsd7a	T	A	6: 12,555,636 (GRCm39)	T83S	possibly damaging	Het
Tln2	A	G	9: 67,170,187 (GRCm39)	S1989P	probably damaging	Het
Tnfaip3	T	G	10: 18,881,324 (GRCm39)	T321P	probably benign	Het
Tnrc6b	C	T	15: 80,808,320 (GRCm39)	P1623L	possibly damaging	Het
Trpa1	T	C	1: 14,982,601 (GRCm39)	N85S	probably benign	Het
Trrap	C	T	5: 144,788,066 (GRCm39)	R3544*	probably null	Het
Ttf2	A	T	3: 100,859,869 (GRCm39)	V695E	probably benign	Het
Ttll4	A	G	1: 74,720,512 (GRCm39)	E509G	probably damaging	Het
Vdr	T	C	15: 97,767,709 (GRCm39)	I94V	probably damaging	Het
Wdfy3	G	T	5: 102,031,911 (GRCm39)	Q2304K	possibly damaging	Het
Zfp663	T	C	2: 165,200,935 (GRCm39)	Y33C	probably damaging	Het

Other mutations in Chd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00478:Chd3	APN	11	69,247,888 (GRCm39)	missense	probably damaging	0.96
IGL00551:Chd3	APN	11	69,237,455 (GRCm39)	missense	probably damaging	1.00
IGL00661:Chd3	APN	11	69,248,209 (GRCm39)	missense	possibly damaging	0.84
IGL00698:Chd3	APN	11	69,240,697 (GRCm39)	missense	probably damaging	0.98
IGL01075:Chd3	APN	11	69,250,791 (GRCm39)	missense	probably damaging	1.00
IGL01309:Chd3	APN	11	69,248,557 (GRCm39)	missense	probably damaging	0.99
IGL01317:Chd3	APN	11	69,244,037 (GRCm39)	missense	probably damaging	1.00
IGL01374:Chd3	APN	11	69,250,806 (GRCm39)	missense	probably damaging	0.99
IGL01444:Chd3	APN	11	69,239,568 (GRCm39)	missense	probably benign	0.28
IGL01617:Chd3	APN	11	69,249,060 (GRCm39)	unclassified	probably benign
IGL01635:Chd3	APN	11	69,252,076 (GRCm39)	splice site	probably benign
IGL01942:Chd3	APN	11	69,240,931 (GRCm39)	critical splice donor site	probably null
IGL01962:Chd3	APN	11	69,248,319 (GRCm39)	missense	possibly damaging	0.46
IGL01981:Chd3	APN	11	69,251,501 (GRCm39)	missense	probably damaging	0.99
IGL02022:Chd3	APN	11	69,251,886 (GRCm39)	missense	probably damaging	1.00
IGL02098:Chd3	APN	11	69,250,655 (GRCm39)	missense	probably damaging	1.00
IGL02218:Chd3	APN	11	69,242,920 (GRCm39)	unclassified	probably benign
IGL02415:Chd3	APN	11	69,239,739 (GRCm39)	splice site	probably benign
IGL02648:Chd3	APN	11	69,242,976 (GRCm39)	missense	probably damaging	1.00
IGL02951:Chd3	APN	11	69,251,874 (GRCm39)	critical splice donor site	probably null
IGL03030:Chd3	APN	11	69,245,230 (GRCm39)	missense	possibly damaging	0.64
IGL03102:Chd3	APN	11	69,252,022 (GRCm39)	nonsense	probably null
IGL03168:Chd3	APN	11	69,239,741 (GRCm39)	splice site	probably benign
IGL03327:Chd3	APN	11	69,241,012 (GRCm39)	missense	probably damaging	1.00
burg	UTSW	11	69,247,380 (GRCm39)	missense	probably damaging	1.00
castello	UTSW	11	69,246,648 (GRCm39)	critical splice acceptor site	probably benign
feste	UTSW	11	69,245,252 (GRCm39)	nonsense	probably null
Fortress	UTSW	11	69,254,876 (GRCm39)	nonsense	probably null
moat	UTSW	11	69,250,011 (GRCm39)	missense	probably damaging	0.98
Redoubt	UTSW	11	69,244,727 (GRCm39)	unclassified	probably benign
schloss	UTSW	11	69,252,886 (GRCm39)	nonsense	probably null
siege	UTSW	11	69,247,844 (GRCm39)	missense	probably damaging	1.00
R0009:Chd3	UTSW	11	69,240,732 (GRCm39)	missense	probably damaging	0.99
R0009:Chd3	UTSW	11	69,240,732 (GRCm39)	missense	probably damaging	0.99
R0056:Chd3	UTSW	11	69,250,739 (GRCm39)	unclassified	probably benign
R0129:Chd3	UTSW	11	69,239,327 (GRCm39)	nonsense	probably null
R0130:Chd3	UTSW	11	69,250,656 (GRCm39)	missense	probably damaging	1.00
R0309:Chd3	UTSW	11	69,247,844 (GRCm39)	missense	probably damaging	1.00
R0330:Chd3	UTSW	11	69,247,159 (GRCm39)	missense	probably damaging	1.00
R0449:Chd3	UTSW	11	69,248,367 (GRCm39)	missense	probably damaging	0.98
R0502:Chd3	UTSW	11	69,244,931 (GRCm39)	missense	probably damaging	0.98
R0540:Chd3	UTSW	11	69,235,184 (GRCm39)	missense	probably damaging	0.98
R0571:Chd3	UTSW	11	69,252,495 (GRCm39)	critical splice donor site	probably null
R0607:Chd3	UTSW	11	69,235,184 (GRCm39)	missense	probably damaging	0.98
R0616:Chd3	UTSW	11	69,236,313 (GRCm39)	missense	probably damaging	0.96
R0630:Chd3	UTSW	11	69,238,021 (GRCm39)	missense	probably damaging	1.00
R1436:Chd3	UTSW	11	69,248,400 (GRCm39)	splice site	probably null
R1484:Chd3	UTSW	11	69,250,725 (GRCm39)	missense	probably benign	0.17
R1741:Chd3	UTSW	11	69,246,480 (GRCm39)	missense	probably damaging	1.00
R1748:Chd3	UTSW	11	69,255,523 (GRCm39)	missense	possibly damaging	0.81
R1751:Chd3	UTSW	11	69,244,727 (GRCm39)	unclassified	probably benign
R1833:Chd3	UTSW	11	69,244,949 (GRCm39)	missense	probably damaging	1.00
R2012:Chd3	UTSW	11	69,239,878 (GRCm39)	missense	probably benign	0.01
R2101:Chd3	UTSW	11	69,239,877 (GRCm39)	missense	probably benign
R2147:Chd3	UTSW	11	69,239,854 (GRCm39)	missense	probably benign	0.00
R2513:Chd3	UTSW	11	69,251,471 (GRCm39)	missense	probably damaging	1.00
R2877:Chd3	UTSW	11	69,251,998 (GRCm39)	nonsense	probably null
R2879:Chd3	UTSW	11	69,254,924 (GRCm39)	missense	possibly damaging	0.52
R2880:Chd3	UTSW	11	69,242,946 (GRCm39)	missense	probably damaging	1.00
R2881:Chd3	UTSW	11	69,242,946 (GRCm39)	missense	probably damaging	1.00
R2973:Chd3	UTSW	11	69,251,442 (GRCm39)	missense	probably damaging	1.00
R3611:Chd3	UTSW	11	69,252,973 (GRCm39)	missense	possibly damaging	0.53
R3743:Chd3	UTSW	11	69,254,876 (GRCm39)	nonsense	probably null
R3845:Chd3	UTSW	11	69,237,585 (GRCm39)	missense	possibly damaging	0.65
R3889:Chd3	UTSW	11	69,250,011 (GRCm39)	missense	probably damaging	0.98
R4007:Chd3	UTSW	11	69,239,827 (GRCm39)	missense	probably benign
R4115:Chd3	UTSW	11	69,248,343 (GRCm39)	missense	possibly damaging	0.95
R4515:Chd3	UTSW	11	69,240,703 (GRCm39)	missense	probably benign	0.00
R4612:Chd3	UTSW	11	69,244,035 (GRCm39)	nonsense	probably null
R4622:Chd3	UTSW	11	69,239,834 (GRCm39)	missense	probably damaging	0.98
R4634:Chd3	UTSW	11	69,253,013 (GRCm39)	unclassified	probably benign
R4635:Chd3	UTSW	11	69,253,013 (GRCm39)	unclassified	probably benign
R4859:Chd3	UTSW	11	69,250,722 (GRCm39)	missense	possibly damaging	0.79
R4930:Chd3	UTSW	11	69,245,034 (GRCm39)	unclassified	probably benign
R5173:Chd3	UTSW	11	69,260,069 (GRCm39)	unclassified	probably benign
R5287:Chd3	UTSW	11	69,239,895 (GRCm39)	splice site	probably null
R5403:Chd3	UTSW	11	69,239,895 (GRCm39)	splice site	probably null
R5511:Chd3	UTSW	11	69,252,301 (GRCm39)	missense	probably damaging	1.00
R5666:Chd3	UTSW	11	69,244,177 (GRCm39)	missense	possibly damaging	0.83
R5702:Chd3	UTSW	11	69,252,261 (GRCm39)	missense	possibly damaging	0.46
R6045:Chd3	UTSW	11	69,242,944 (GRCm39)	missense	possibly damaging	0.90
R6063:Chd3	UTSW	11	69,240,063 (GRCm39)	missense	probably benign
R6211:Chd3	UTSW	11	69,243,503 (GRCm39)	missense	probably damaging	1.00
R6215:Chd3	UTSW	11	69,247,380 (GRCm39)	missense	probably damaging	1.00
R6217:Chd3	UTSW	11	69,236,361 (GRCm39)	missense	probably damaging	1.00
R6302:Chd3	UTSW	11	69,244,604 (GRCm39)	missense	probably damaging	0.98
R6329:Chd3	UTSW	11	69,252,510 (GRCm39)	missense	possibly damaging	0.70
R6349:Chd3	UTSW	11	69,254,857 (GRCm39)	missense	possibly damaging	0.50
R6414:Chd3	UTSW	11	69,243,371 (GRCm39)	critical splice donor site	probably null
R6453:Chd3	UTSW	11	69,240,938 (GRCm39)	nonsense	probably null
R6548:Chd3	UTSW	11	69,252,886 (GRCm39)	nonsense	probably null
R6582:Chd3	UTSW	11	69,259,982 (GRCm39)	unclassified	probably benign
R6721:Chd3	UTSW	11	69,260,045 (GRCm39)	unclassified	probably benign
R6900:Chd3	UTSW	11	69,245,271 (GRCm39)	missense	possibly damaging	0.64
R7085:Chd3	UTSW	11	69,260,027 (GRCm39)	missense	unknown
R7136:Chd3	UTSW	11	69,239,264 (GRCm39)	missense	probably null	0.37
R7164:Chd3	UTSW	11	69,253,132 (GRCm39)	missense	probably damaging	1.00
R7200:Chd3	UTSW	11	69,254,921 (GRCm39)	missense	possibly damaging	0.94
R7226:Chd3	UTSW	11	69,260,037 (GRCm39)	missense	unknown
R7238:Chd3	UTSW	11	69,254,873 (GRCm39)	missense	probably benign	0.31
R7316:Chd3	UTSW	11	69,236,394 (GRCm39)	missense	probably damaging	0.99
R7560:Chd3	UTSW	11	69,247,096 (GRCm39)	missense	probably damaging	1.00
R7684:Chd3	UTSW	11	69,248,692 (GRCm39)	missense	possibly damaging	0.83
R7748:Chd3	UTSW	11	69,246,459 (GRCm39)	missense	probably benign	0.00
R7820:Chd3	UTSW	11	69,244,064 (GRCm39)	missense	probably damaging	1.00
R7885:Chd3	UTSW	11	69,247,451 (GRCm39)	missense	probably benign	0.13
R8150:Chd3	UTSW	11	69,254,510 (GRCm39)	missense	probably benign	0.02
R8161:Chd3	UTSW	11	69,241,711 (GRCm39)	missense	probably damaging	1.00
R8271:Chd3	UTSW	11	69,251,483 (GRCm39)	missense	probably damaging	1.00
R8334:Chd3	UTSW	11	69,241,622 (GRCm39)	missense	probably damaging	1.00
R8423:Chd3	UTSW	11	69,245,252 (GRCm39)	nonsense	probably null
R8690:Chd3	UTSW	11	69,246,648 (GRCm39)	critical splice acceptor site	probably benign
R8828:Chd3	UTSW	11	69,247,097 (GRCm39)	missense	probably damaging	1.00
R8857:Chd3	UTSW	11	69,253,146 (GRCm39)	missense	probably benign	0.22
R9124:Chd3	UTSW	11	69,260,162 (GRCm39)	missense	unknown
R9170:Chd3	UTSW	11	69,241,648 (GRCm39)	missense	possibly damaging	0.64
R9213:Chd3	UTSW	11	69,255,628 (GRCm39)	missense	possibly damaging	0.53
R9285:Chd3	UTSW	11	69,249,954 (GRCm39)	missense	possibly damaging	0.64
R9293:Chd3	UTSW	11	69,244,027 (GRCm39)	missense	possibly damaging	0.94
R9368:Chd3	UTSW	11	69,251,200 (GRCm39)	missense	probably damaging	1.00
R9521:Chd3	UTSW	11	69,249,133 (GRCm39)	missense	probably benign	0.01
R9544:Chd3	UTSW	11	69,241,046 (GRCm39)	missense	probably damaging	1.00
R9554:Chd3	UTSW	11	69,251,015 (GRCm39)	missense	probably damaging	1.00
R9588:Chd3	UTSW	11	69,241,046 (GRCm39)	missense	probably damaging	1.00
X0022:Chd3	UTSW	11	69,247,084 (GRCm39)	missense	probably damaging	1.00
X0062:Chd3	UTSW	11	69,245,271 (GRCm39)	missense	possibly damaging	0.64
Z1186:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1186:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1187:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1187:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1188:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1188:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1189:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1189:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1190:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1190:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1191:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1191:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1192:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1192:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGCTAGTCTAAGTTTCCAGCGTC -3'
(R):5'- CTTTGAGATAGAACTGGAGGGC -3'

Sequencing Primer
(F):5'- CGTCTCCCATCCTAAGGACACG -3'
(R):5'- CTGGGGCTAAGTAGAGTGAGTAGAC -3'

Posted On

2018-08-29