Incidental Mutation 'R6781:Mfsd10'
ID531413
Institutional Source Beutler Lab
Gene Symbol Mfsd10
Ensembl Gene ENSMUSG00000001082
Gene Namemajor facilitator superfamily domain containing 10
SynonymsTetran, 0610009O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6781 (G1)
Quality Score204.009
Status Validated
Chromosome5
Chromosomal Location34633642-34637212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34634509 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 344 (M344K)
Ref Sequence ENSEMBL: ENSMUSP00000109970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001108] [ENSMUST00000001109] [ENSMUST00000041364] [ENSMUST00000052836] [ENSMUST00000114329] [ENSMUST00000114331] [ENSMUST00000114335] [ENSMUST00000114338] [ENSMUST00000114340] [ENSMUST00000124668] [ENSMUST00000126257] [ENSMUST00000134156] [ENSMUST00000137150] [ENSMUST00000137506] [ENSMUST00000149657] [ENSMUST00000155577] [ENSMUST00000201147] [ENSMUST00000201810] [ENSMUST00000202378]
Predicted Effect probably benign
Transcript: ENSMUST00000001108
SMART Domains Protein: ENSMUSP00000001108
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 599 631 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000001109
AA Change: M344K

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000001109
Gene: ENSMUSG00000001082
AA Change: M344K

DomainStartEndE-ValueType
Pfam:MFS_1 29 413 6.9e-41 PFAM
Pfam:Sugar_tr 62 235 7.9e-9 PFAM
transmembrane domain 422 444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041364
SMART Domains Protein: ENSMUSP00000038382
Gene: ENSMUSG00000036693

DomainStartEndE-ValueType
Pfam:Nop14 21 849 2.2e-273 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052836
SMART Domains Protein: ENSMUSP00000052266
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 599 631 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114329
AA Change: M344K

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109968
Gene: ENSMUSG00000001082
AA Change: M344K

DomainStartEndE-ValueType
Pfam:MFS_1 29 413 6.8e-41 PFAM
Pfam:Sugar_tr 71 228 2.3e-9 PFAM
transmembrane domain 422 444 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114331
AA Change: M344K

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109970
Gene: ENSMUSG00000001082
AA Change: M344K

DomainStartEndE-ValueType
Pfam:MFS_1 29 413 6.8e-41 PFAM
Pfam:Sugar_tr 71 228 2.3e-9 PFAM
transmembrane domain 422 444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114335
SMART Domains Protein: ENSMUSP00000109974
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 597 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114338
SMART Domains Protein: ENSMUSP00000109977
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 568 600 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114340
SMART Domains Protein: ENSMUSP00000109979
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 568 600 N/A INTRINSIC
low complexity region 666 685 N/A INTRINSIC
low complexity region 698 719 N/A INTRINSIC
low complexity region 727 733 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124668
SMART Domains Protein: ENSMUSP00000119140
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126257
SMART Domains Protein: ENSMUSP00000144630
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 139 5.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134156
SMART Domains Protein: ENSMUSP00000143812
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137150
SMART Domains Protein: ENSMUSP00000120814
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137506
SMART Domains Protein: ENSMUSP00000144121
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 31 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149657
SMART Domains Protein: ENSMUSP00000118786
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 261 1.3e-26 PFAM
Pfam:Sugar_tr 71 228 9.3e-10 PFAM
Pfam:TRI12 76 232 3.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152805
SMART Domains Protein: ENSMUSP00000121402
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
coiled coil region 95 127 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155577
SMART Domains Protein: ENSMUSP00000115204
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 269 1.1e-27 PFAM
Pfam:Sugar_tr 71 228 9.6e-10 PFAM
Pfam:TRI12 76 232 3.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201147
SMART Domains Protein: ENSMUSP00000144239
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
low complexity region 80 95 N/A INTRINSIC
low complexity region 104 130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201810
SMART Domains Protein: ENSMUSP00000144673
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
coiled coil region 142 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202065
Predicted Effect probably benign
Transcript: ENSMUST00000202378
SMART Domains Protein: ENSMUSP00000144117
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
transmembrane domain 24 43 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the major facilitator superfamily of transporter proteins. The encoded protein likely functions in efflux of organic anions, including the non-steroidal anti-inflammatory drugs indomethacin and diclofenac. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,374,406 I259N possibly damaging Het
Acot12 G T 13: 91,784,412 probably null Het
AI182371 G T 2: 35,084,705 probably benign Het
Amigo3 T C 9: 108,053,963 L195P probably damaging Het
Aox4 A T 1: 58,245,109 D556V probably benign Het
Arhgef40 A C 14: 51,997,897 probably benign Het
Asb15 T C 6: 24,558,675 V63A probably benign Het
Bicd1 T C 6: 149,513,166 I459T possibly damaging Het
Bub1 C A 2: 127,807,857 G694W probably damaging Het
C4b A T 17: 34,742,954 I106N probably damaging Het
Clca4b T C 3: 144,922,801 I382V probably benign Het
Cntnap5a A C 1: 116,292,397 S646R probably benign Het
Cntnap5c C T 17: 58,138,653 Q563* probably null Het
Cpn1 A G 19: 43,980,904 F107L possibly damaging Het
Csrnp3 T A 2: 66,022,271 C336S probably benign Het
Defa3 T A 8: 21,288,261 M87K probably benign Het
Dmbt1 T C 7: 131,046,561 F274L probably benign Het
Dnah8 TTA TTATA 17: 30,765,724 probably null Het
Dnase2b T C 3: 146,582,371 H323R probably benign Het
Fam83e A T 7: 45,722,147 probably benign Het
Fbn1 T C 2: 125,317,038 N2269S probably damaging Het
Foxa1 A T 12: 57,543,257 M59K possibly damaging Het
Fpr3 T C 17: 17,970,716 V83A probably benign Het
Frmd6 A G 12: 70,899,643 D615G possibly damaging Het
Gfra3 T C 18: 34,711,322 K55R possibly damaging Het
Gm5414 A T 15: 101,625,661 S296T possibly damaging Het
Gtf3c1 T A 7: 125,659,197 K1234* probably null Het
Hltf T A 3: 20,098,166 Y609N probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ift74 A G 4: 94,627,302 D152G probably damaging Het
Kcnk6 T C 7: 29,225,055 Y308C probably damaging Het
Klhl29 A G 12: 5,091,347 S546P probably damaging Het
Map7d1 AGGGCAGCC AGGGCAGCCGGGCAGCC 4: 126,240,751 probably null Het
Meis2 T A 2: 116,049,155 H228L probably benign Het
Mrps33 T C 6: 39,805,823 probably benign Het
Olfr1198 A T 2: 88,746,830 N19K probably benign Het
Olfr437 A G 6: 43,167,388 E110G probably damaging Het
Pik3cb T C 9: 99,040,992 T996A possibly damaging Het
Plekha7 A G 7: 116,157,855 probably null Het
Ppp1cb A G 5: 32,480,762 Y86C probably damaging Het
Sass6 T G 3: 116,595,124 probably benign Het
Slc6a15 A T 10: 103,395,067 I218F probably damaging Het
St5 T C 7: 109,525,304 D1110G possibly damaging Het
Tcf23 C T 5: 30,968,960 P61L probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zc3h6 T C 2: 129,015,421 F620S probably damaging Het
Other mutations in Mfsd10
AlleleSourceChrCoordTypePredicted EffectPPH Score
E0374:Mfsd10 UTSW 5 34636637 unclassified probably null
R0226:Mfsd10 UTSW 5 34634446 missense probably benign 0.03
R0265:Mfsd10 UTSW 5 34635163 splice site probably benign
R1803:Mfsd10 UTSW 5 34636750 missense possibly damaging 0.81
R4235:Mfsd10 UTSW 5 34635625 missense probably damaging 0.99
R4782:Mfsd10 UTSW 5 34634949 intron probably benign
R5861:Mfsd10 UTSW 5 34634244 unclassified probably benign
R7381:Mfsd10 UTSW 5 34636426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGGAGACCATGGTGGAC -3'
(R):5'- AAGCCTTTGTGGTACCCCTC -3'

Sequencing Primer
(F):5'- AGACCATGGTGGACAGACC -3'
(R):5'- CAGCAGGGCAAGATGTTTTTC -3'
Posted On2018-08-29