Incidental Mutation 'R6781:Olfr437'
ID531415
Institutional Source Beutler Lab
Gene Symbol Olfr437
Ensembl Gene ENSMUSG00000071481
Gene Nameolfactory receptor 437
SynonymsGA_x6K02T2P3E9-4391088-4390156, MOR261-11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R6781 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location43163282-43169861 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43167388 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 110 (E110G)
Ref Sequence ENSEMBL: ENSMUSP00000145490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060243] [ENSMUST00000205175] [ENSMUST00000216179]
Predicted Effect probably damaging
Transcript: ENSMUST00000060243
AA Change: E110G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058147
Gene: ENSMUSG00000071481
AA Change: E110G

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 7.5e-60 PFAM
Pfam:7tm_1 40 289 3e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205175
AA Change: E110G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145490
Gene: ENSMUSG00000071481
AA Change: E110G

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 7.5e-60 PFAM
Pfam:7tm_1 40 289 3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216179
Meta Mutation Damage Score 0.0368 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,374,406 I259N possibly damaging Het
Acot12 G T 13: 91,784,412 probably null Het
AI182371 G T 2: 35,084,705 probably benign Het
Amigo3 T C 9: 108,053,963 L195P probably damaging Het
Aox4 A T 1: 58,245,109 D556V probably benign Het
Arhgef40 A C 14: 51,997,897 probably benign Het
Asb15 T C 6: 24,558,675 V63A probably benign Het
Bicd1 T C 6: 149,513,166 I459T possibly damaging Het
Bub1 C A 2: 127,807,857 G694W probably damaging Het
C4b A T 17: 34,742,954 I106N probably damaging Het
Clca4b T C 3: 144,922,801 I382V probably benign Het
Cntnap5a A C 1: 116,292,397 S646R probably benign Het
Cntnap5c C T 17: 58,138,653 Q563* probably null Het
Cpn1 A G 19: 43,980,904 F107L possibly damaging Het
Csrnp3 T A 2: 66,022,271 C336S probably benign Het
Defa3 T A 8: 21,288,261 M87K probably benign Het
Dmbt1 T C 7: 131,046,561 F274L probably benign Het
Dnah8 TTA TTATA 17: 30,765,724 probably null Het
Dnase2b T C 3: 146,582,371 H323R probably benign Het
Fam83e A T 7: 45,722,147 probably benign Het
Fbn1 T C 2: 125,317,038 N2269S probably damaging Het
Foxa1 A T 12: 57,543,257 M59K possibly damaging Het
Fpr3 T C 17: 17,970,716 V83A probably benign Het
Frmd6 A G 12: 70,899,643 D615G possibly damaging Het
Gfra3 T C 18: 34,711,322 K55R possibly damaging Het
Gm5414 A T 15: 101,625,661 S296T possibly damaging Het
Gtf3c1 T A 7: 125,659,197 K1234* probably null Het
Hltf T A 3: 20,098,166 Y609N probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ift74 A G 4: 94,627,302 D152G probably damaging Het
Kcnk6 T C 7: 29,225,055 Y308C probably damaging Het
Klhl29 A G 12: 5,091,347 S546P probably damaging Het
Map7d1 AGGGCAGCC AGGGCAGCCGGGCAGCC 4: 126,240,751 probably null Het
Meis2 T A 2: 116,049,155 H228L probably benign Het
Mfsd10 A T 5: 34,634,509 M344K possibly damaging Het
Mrps33 T C 6: 39,805,823 probably benign Het
Olfr1198 A T 2: 88,746,830 N19K probably benign Het
Pik3cb T C 9: 99,040,992 T996A possibly damaging Het
Plekha7 A G 7: 116,157,855 probably null Het
Ppp1cb A G 5: 32,480,762 Y86C probably damaging Het
Sass6 T G 3: 116,595,124 probably benign Het
Slc6a15 A T 10: 103,395,067 I218F probably damaging Het
St5 T C 7: 109,525,304 D1110G possibly damaging Het
Tcf23 C T 5: 30,968,960 P61L probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zc3h6 T C 2: 129,015,421 F620S probably damaging Het
Other mutations in Olfr437
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Olfr437 APN 6 43167390 missense probably damaging 1.00
IGL01618:Olfr437 APN 6 43167703 missense probably damaging 0.97
IGL02426:Olfr437 APN 6 43167088 missense probably benign 0.02
R0548:Olfr437 UTSW 6 43167187 missense probably benign 0.43
R0856:Olfr437 UTSW 6 43167411 missense probably damaging 1.00
R1590:Olfr437 UTSW 6 43167912 missense probably damaging 1.00
R1902:Olfr437 UTSW 6 43167723 unclassified probably null
R3894:Olfr437 UTSW 6 43167258 missense probably benign 0.23
R5083:Olfr437 UTSW 6 43167339 missense probably benign 0.33
R5278:Olfr437 UTSW 6 43167721 missense probably damaging 1.00
R6246:Olfr437 UTSW 6 43167502 unclassified probably null
R6807:Olfr437 UTSW 6 43167238 missense probably damaging 1.00
R7253:Olfr437 UTSW 6 43167810 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAGTCATCTGCCTGGACC -3'
(R):5'- CCAGGATTTCACAGAAGAGGTG -3'

Sequencing Primer
(F):5'- TCATCTGCCTGGACCCCAAG -3'
(R):5'- GTTTATTTCCTGGGGCCCACAAAAG -3'
Posted On2018-08-29