Incidental Mutation 'R6781:Fam83e'
ID531418
Institutional Source Beutler Lab
Gene Symbol Fam83e
Ensembl Gene ENSMUSG00000054161
Gene Namefamily with sequence similarity 83, member E
Synonyms4930403C10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6781 (G1)
Quality Score91.0077
Status Validated
Chromosome7
Chromosomal Location45721212-45729492 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 45722147 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072503] [ENSMUST00000094424] [ENSMUST00000107737] [ENSMUST00000129507] [ENSMUST00000209287] [ENSMUST00000209693] [ENSMUST00000210060] [ENSMUST00000210640] [ENSMUST00000211061] [ENSMUST00000211435]
Predicted Effect probably benign
Transcript: ENSMUST00000072503
SMART Domains Protein: ENSMUSP00000072320
Gene: ENSMUSG00000059070

DomainStartEndE-ValueType
PDB:2ZKR|O 1 188 1e-116 PDB
SCOP:d1jj2n_ 22 139 1e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094424
SMART Domains Protein: ENSMUSP00000091991
Gene: ENSMUSG00000070563

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:UPAR_LY6 23 97 1.7e-7 PFAM
low complexity region 99 123 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107737
SMART Domains Protein: ENSMUSP00000103366
Gene: ENSMUSG00000057342

DomainStartEndE-ValueType
SCOP:d1epfa2 63 87 1e-2 SMART
DAGKc 147 284 4.49e-5 SMART
low complexity region 369 376 N/A INTRINSIC
low complexity region 429 440 N/A INTRINSIC
PDB:3VZB|C 468 609 4e-25 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000129507
SMART Domains Protein: ENSMUSP00000114397
Gene: ENSMUSG00000054161

DomainStartEndE-ValueType
Pfam:DUF1669 18 293 4.8e-105 PFAM
low complexity region 371 385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209287
Predicted Effect probably benign
Transcript: ENSMUST00000209556
Predicted Effect probably benign
Transcript: ENSMUST00000209693
Predicted Effect probably benign
Transcript: ENSMUST00000209867
Predicted Effect probably benign
Transcript: ENSMUST00000210060
Predicted Effect probably benign
Transcript: ENSMUST00000210640
Predicted Effect probably benign
Transcript: ENSMUST00000211061
Predicted Effect probably benign
Transcript: ENSMUST00000211435
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,374,406 I259N possibly damaging Het
Acot12 G T 13: 91,784,412 probably null Het
AI182371 G T 2: 35,084,705 probably benign Het
Amigo3 T C 9: 108,053,963 L195P probably damaging Het
Aox4 A T 1: 58,245,109 D556V probably benign Het
Arhgef40 A C 14: 51,997,897 probably benign Het
Asb15 T C 6: 24,558,675 V63A probably benign Het
Bicd1 T C 6: 149,513,166 I459T possibly damaging Het
Bub1 C A 2: 127,807,857 G694W probably damaging Het
C4b A T 17: 34,742,954 I106N probably damaging Het
Clca4b T C 3: 144,922,801 I382V probably benign Het
Cntnap5a A C 1: 116,292,397 S646R probably benign Het
Cntnap5c C T 17: 58,138,653 Q563* probably null Het
Cpn1 A G 19: 43,980,904 F107L possibly damaging Het
Csrnp3 T A 2: 66,022,271 C336S probably benign Het
Defa3 T A 8: 21,288,261 M87K probably benign Het
Dmbt1 T C 7: 131,046,561 F274L probably benign Het
Dnah8 TTA TTATA 17: 30,765,724 probably null Het
Dnase2b T C 3: 146,582,371 H323R probably benign Het
Fbn1 T C 2: 125,317,038 N2269S probably damaging Het
Foxa1 A T 12: 57,543,257 M59K possibly damaging Het
Fpr3 T C 17: 17,970,716 V83A probably benign Het
Frmd6 A G 12: 70,899,643 D615G possibly damaging Het
Gfra3 T C 18: 34,711,322 K55R possibly damaging Het
Gm5414 A T 15: 101,625,661 S296T possibly damaging Het
Gtf3c1 T A 7: 125,659,197 K1234* probably null Het
Hltf T A 3: 20,098,166 Y609N probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ift74 A G 4: 94,627,302 D152G probably damaging Het
Kcnk6 T C 7: 29,225,055 Y308C probably damaging Het
Klhl29 A G 12: 5,091,347 S546P probably damaging Het
Map7d1 AGGGCAGCC AGGGCAGCCGGGCAGCC 4: 126,240,751 probably null Het
Meis2 T A 2: 116,049,155 H228L probably benign Het
Mfsd10 A T 5: 34,634,509 M344K possibly damaging Het
Mrps33 T C 6: 39,805,823 probably benign Het
Olfr1198 A T 2: 88,746,830 N19K probably benign Het
Olfr437 A G 6: 43,167,388 E110G probably damaging Het
Pik3cb T C 9: 99,040,992 T996A possibly damaging Het
Plekha7 A G 7: 116,157,855 probably null Het
Ppp1cb A G 5: 32,480,762 Y86C probably damaging Het
Sass6 T G 3: 116,595,124 probably benign Het
Slc6a15 A T 10: 103,395,067 I218F probably damaging Het
St5 T C 7: 109,525,304 D1110G possibly damaging Het
Tcf23 C T 5: 30,968,960 P61L probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zc3h6 T C 2: 129,015,421 F620S probably damaging Het
Other mutations in Fam83e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Fam83e APN 7 45727069 missense probably benign 0.12
IGL01590:Fam83e APN 7 45723936 missense probably null 1.00
IGL02334:Fam83e APN 7 45723921 missense probably benign 0.00
IGL03155:Fam83e APN 7 45727075 missense possibly damaging 0.90
IGL03276:Fam83e APN 7 45723460 missense possibly damaging 0.72
R0268:Fam83e UTSW 7 45726910 missense probably benign
R0362:Fam83e UTSW 7 45726969 missense probably benign 0.40
R0453:Fam83e UTSW 7 45723948 missense probably damaging 1.00
R0832:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R0870:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R0871:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R1415:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R1574:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R1574:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R1656:Fam83e UTSW 7 45722263 missense probably benign
R1848:Fam83e UTSW 7 45728769 nonsense probably null
R1848:Fam83e UTSW 7 45728770 missense possibly damaging 0.79
R2189:Fam83e UTSW 7 45722183 start codon destroyed probably null 0.88
R2256:Fam83e UTSW 7 45728769 nonsense probably null
R2256:Fam83e UTSW 7 45728770 missense possibly damaging 0.79
R2257:Fam83e UTSW 7 45728769 nonsense probably null
R2257:Fam83e UTSW 7 45728770 missense possibly damaging 0.79
R4376:Fam83e UTSW 7 45723893 missense probably damaging 1.00
R4600:Fam83e UTSW 7 45723500 missense probably benign 0.01
R5876:Fam83e UTSW 7 45722363 unclassified probably null
R6666:Fam83e UTSW 7 45727002 missense probably benign
R6766:Fam83e UTSW 7 45726646 missense probably damaging 1.00
R6933:Fam83e UTSW 7 45722394 missense probably benign
R7320:Fam83e UTSW 7 45722472 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CAGGCACATGTGATCAGATCC -3'
(R):5'- TGAGCCTCATCTGCACTCAG -3'

Sequencing Primer
(F):5'- CACATGTGATCAGATCCATGGTG -3'
(R):5'- AGAAAGTCTCCTCGCCACTG -3'
Posted On2018-08-29