Incidental Mutation 'R6782:Zfp975'
ID531462
Institutional Source Beutler Lab
Gene Symbol Zfp975
Ensembl Gene ENSMUSG00000069727
Gene Namezinc finger protein 975
SynonymsGm5595
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6782 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location42660105-42692742 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 42662030 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 386 (N386K)
Ref Sequence ENSEMBL: ENSMUSP00000103626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107992]
Predicted Effect probably benign
Transcript: ENSMUST00000107992
AA Change: N386K

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103626
Gene: ENSMUSG00000069727
AA Change: N386K

DomainStartEndE-ValueType
KRAB 4 66 1.53e-19 SMART
ZnF_C2H2 131 153 7.78e-3 SMART
ZnF_C2H2 159 181 9.73e-4 SMART
ZnF_C2H2 187 209 1.47e-3 SMART
ZnF_C2H2 215 237 3.89e-3 SMART
ZnF_C2H2 243 265 2.57e-3 SMART
ZnF_C2H2 271 293 7.26e-3 SMART
ZnF_C2H2 299 321 1.58e-3 SMART
ZnF_C2H2 327 349 7.9e-4 SMART
ZnF_C2H2 355 377 5.9e-3 SMART
ZnF_C2H2 383 405 1.58e-3 SMART
ZnF_C2H2 411 433 6.32e-3 SMART
ZnF_C2H2 439 461 8.47e-4 SMART
ZnF_C2H2 467 489 2.57e-3 SMART
ZnF_C2H2 495 517 3.16e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C T 7: 120,248,085 A724V probably damaging Het
Abcc3 A T 11: 94,358,950 F1055L probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Ankrd17 T C 5: 90,254,738 K1488R possibly damaging Het
Ano1 G A 7: 144,621,687 T498I probably damaging Het
Arhgap42 T A 9: 9,115,720 K118N probably damaging Het
Arl5b A G 2: 15,073,182 E106G probably damaging Het
Atp5g3 C T 2: 73,909,328 R56Q probably benign Het
Bbx T C 16: 50,200,565 R749G probably benign Het
Cacna1g A G 11: 94,459,550 S490P probably damaging Het
Ccdc63 A T 5: 122,111,014 Y417* probably null Het
Cep162 A T 9: 87,211,684 N880K probably benign Het
Chd2 G A 7: 73,475,379 Q77* probably null Het
Cntrl T G 2: 35,170,646 M1397R possibly damaging Het
Dcaf7 A G 11: 106,054,755 Y310C probably damaging Het
Dnah5 T A 15: 28,449,156 S4235T possibly damaging Het
Dot1l C T 10: 80,789,390 P1157L probably damaging Het
Esco2 T C 14: 65,820,016 T577A probably benign Het
Foxp1 T C 6: 98,930,145 D624G probably damaging Het
Gfi1 A T 5: 107,725,953 probably null Het
Gm10985 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 3: 53,845,205 probably null Het
Gm5113 G A 7: 30,178,753 V89I probably benign Het
Gtf3c2 A C 5: 31,169,836 L382R probably benign Het
Hhip T C 8: 80,051,604 N99S probably damaging Het
Hist1h3b T C 13: 23,752,410 S11P probably benign Het
Htr5b T C 1: 121,510,498 I335V probably benign Het
Ifi206 A G 1: 173,481,357 S358P unknown Het
Loxhd1 T A 18: 77,431,177 V1893D probably damaging Het
Mical2 A G 7: 112,346,761 R11G probably damaging Het
Mrc1 T C 2: 14,261,337 probably null Het
Npr1 T C 3: 90,456,253 N821S probably benign Het
Olfr1279 A G 2: 111,306,745 D180G probably damaging Het
Olfr487 T C 7: 108,212,463 D22G probably benign Het
Olfr495 T G 7: 108,395,537 M139R probably damaging Het
Olfr628 A G 7: 103,732,342 T139A possibly damaging Het
Pi4ka T A 16: 17,325,988 D739V probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Ptprd T C 4: 76,325,140 probably null Het
Ralgapb G A 2: 158,436,566 G5R probably damaging Het
Ric8b T C 10: 84,947,527 V83A probably damaging Het
Sdc2 C A 15: 33,028,135 T133K probably damaging Het
Slc12a7 T A 13: 73,798,969 V592D probably damaging Het
Sorcs1 G T 19: 50,176,122 Y990* probably null Het
Spata13 G T 14: 60,691,463 G157W probably damaging Het
Tada1 A G 1: 166,389,972 N226S probably benign Het
Tenm3 A G 8: 48,646,256 probably null Het
Tll1 A G 8: 64,071,281 V457A probably benign Het
Tmem232 T C 17: 65,500,124 K25E possibly damaging Het
Tnrc18 T C 5: 142,787,308 S406G unknown Het
Ush2a A G 1: 188,356,834 M329V probably benign Het
Vmn2r107 T C 17: 20,356,879 S380P probably damaging Het
Vmn2r73 A G 7: 85,870,355 M465T probably benign Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp217 T C 2: 170,116,258 D463G probably damaging Het
Zfp345 T C 2: 150,473,354 S88G probably damaging Het
Other mutations in Zfp975
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:Zfp975 APN 7 42662791 missense probably damaging 1.00
R0194:Zfp975 UTSW 7 42662492 missense probably benign 0.02
R0662:Zfp975 UTSW 7 42662526 missense probably benign 0.02
R1491:Zfp975 UTSW 7 42662812 missense probably benign 0.19
R1573:Zfp975 UTSW 7 42662083 missense probably benign 0.03
R1738:Zfp975 UTSW 7 42662949 missense probably benign 0.05
R1833:Zfp975 UTSW 7 42661839 missense probably benign 0.01
R2185:Zfp975 UTSW 7 42661681 missense possibly damaging 0.90
R4031:Zfp975 UTSW 7 42662953 nonsense probably null
R4090:Zfp975 UTSW 7 42662874 missense probably benign 0.10
R4356:Zfp975 UTSW 7 42661827 missense probably damaging 1.00
R4631:Zfp975 UTSW 7 42662945 missense probably benign 0.09
R4795:Zfp975 UTSW 7 42665146 critical splice acceptor site probably null
R4896:Zfp975 UTSW 7 42662292 missense probably damaging 1.00
R5266:Zfp975 UTSW 7 42662230 missense probably damaging 1.00
R5267:Zfp975 UTSW 7 42662230 missense probably damaging 1.00
R5580:Zfp975 UTSW 7 42665089 nonsense probably null
R5874:Zfp975 UTSW 7 42662888 missense probably benign 0.00
R5898:Zfp975 UTSW 7 42662539 missense probably damaging 1.00
R6529:Zfp975 UTSW 7 42661901 missense possibly damaging 0.79
R6937:Zfp975 UTSW 7 42665056 missense possibly damaging 0.61
R7088:Zfp975 UTSW 7 42662672 missense probably benign 0.02
R7233:Zfp975 UTSW 7 42662494 missense probably benign 0.38
R7253:Zfp975 UTSW 7 42661612 makesense probably null
R7358:Zfp975 UTSW 7 42662791 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAAGATAGTGGGGTTGCA -3'
(R):5'- CAGGTACCTTCGAGCACATGA -3'

Sequencing Primer
(F):5'- GTTGGGTCGTAAAAAGGCTTTACCAC -3'
(R):5'- GGTACCTTCGAGCACATGAAAGAAC -3'
Posted On2018-08-29