Incidental Mutation 'R6783:Ddx31'
ID531496
Institutional Source Beutler Lab
Gene Symbol Ddx31
Ensembl Gene ENSMUSG00000026806
Gene NameDEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.804) question?
Stock #R6783 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location28840406-28905571 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28874176 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 465 (V465I)
Ref Sequence ENSEMBL: ENSMUSP00000109484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113853]
Predicted Effect probably benign
Transcript: ENSMUST00000113853
AA Change: V465I

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000109484
Gene: ENSMUSG00000026806
AA Change: V465I

DomainStartEndE-ValueType
DEXDc 123 332 2.28e-48 SMART
HELICc 408 487 4.02e-26 SMART
DUF4217 556 621 6.21e-22 SMART
Meta Mutation Damage Score 0.152 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.8%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik G A 8: 11,655,661 Q39* probably null Het
5430419D17Rik T C 7: 131,226,764 L316P probably damaging Het
Adam12 T A 7: 133,974,397 Q228L probably damaging Het
Arhgap45 A G 10: 80,017,864 T71A possibly damaging Het
Bag6 T A 17: 35,144,235 S684T possibly damaging Het
BC067074 A T 13: 113,320,209 K930* probably null Het
Bcam C T 7: 19,766,881 G123R probably damaging Het
Cdr2l C T 11: 115,393,669 A277V possibly damaging Het
Clcn4 T A 7: 7,299,182 probably benign Het
Csnk1g1 T A 9: 65,973,512 I72N probably damaging Het
Ddx54 C T 5: 120,618,714 Q163* probably null Het
Dnmt3a A G 12: 3,897,406 E459G probably damaging Het
Dpp8 T C 9: 65,063,562 S568P possibly damaging Het
Drap1 G T 19: 5,424,191 T47K probably damaging Het
Epha7 G T 4: 28,950,528 R777L possibly damaging Het
Far2 T G 6: 148,150,775 probably null Het
Fhdc1 T C 3: 84,445,527 K797R probably benign Het
Gm10330 A T 12: 23,780,093 M29K probably damaging Het
Gm17689 T A 9: 36,581,335 probably null Het
Gm5640 C T X: 74,640,415 R355H probably damaging Homo
Grik3 A T 4: 125,632,300 I109F probably benign Het
Il31ra T C 13: 112,551,988 probably null Het
Itga1 T G 13: 114,996,977 I466L probably benign Het
Itpr2 A T 6: 146,385,873 probably null Het
Mical3 A C 6: 120,958,825 L1580R possibly damaging Het
Olfr299 T A 7: 86,465,627 V72D probably damaging Het
Olfr732 T C 14: 50,282,187 D22G probably benign Het
Palb2 T A 7: 122,127,488 E386D probably damaging Het
Papd4 G A 13: 93,155,018 A368V probably benign Het
Papd4 C G 13: 93,155,019 A372P probably benign Het
Polm C A 11: 5,835,534 R175L probably damaging Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Ptcd3 A T 6: 71,908,643 V33D probably benign Het
Ripk4 C A 16: 97,748,037 R273L probably damaging Het
Rpap2 A G 5: 107,655,287 T612A probably damaging Het
Serpinb10 A G 1: 107,546,867 N253S possibly damaging Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Sim1 T C 10: 50,908,727 I156T possibly damaging Het
Ski A T 4: 155,160,832 probably null Het
Trdn C T 10: 33,438,815 R512C probably damaging Het
Trim33 T C 3: 103,352,087 Y1031H probably damaging Het
Use1 T C 8: 71,369,236 L188P probably damaging Het
Usp34 G A 11: 23,412,318 G1588D probably damaging Het
Vmn2r33 C A 7: 7,563,798 R105L probably benign Het
Vmn2r53 G A 7: 12,601,433 S100F probably damaging Het
Other mutations in Ddx31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01664:Ddx31 APN 2 28875835 splice site probably benign
IGL01918:Ddx31 APN 2 28874164 missense probably damaging 1.00
IGL02174:Ddx31 APN 2 28859029 missense probably damaging 1.00
IGL02560:Ddx31 APN 2 28875826 missense probably damaging 1.00
IGL02938:Ddx31 APN 2 28859023 missense possibly damaging 0.49
R0241:Ddx31 UTSW 2 28848291 missense probably damaging 1.00
R0241:Ddx31 UTSW 2 28848291 missense probably damaging 1.00
R0440:Ddx31 UTSW 2 28857132 missense probably damaging 1.00
R0701:Ddx31 UTSW 2 28858777 missense probably null 1.00
R0729:Ddx31 UTSW 2 28874174 missense probably damaging 1.00
R1227:Ddx31 UTSW 2 28857175 missense probably damaging 1.00
R1532:Ddx31 UTSW 2 28881159 missense probably benign 0.00
R1608:Ddx31 UTSW 2 28859066 missense probably damaging 0.97
R1646:Ddx31 UTSW 2 28892520 missense probably benign
R1674:Ddx31 UTSW 2 28858816 missense probably damaging 1.00
R1834:Ddx31 UTSW 2 28892453 missense probably damaging 1.00
R1884:Ddx31 UTSW 2 28858990 missense probably damaging 0.97
R4133:Ddx31 UTSW 2 28858852 missense probably damaging 1.00
R4911:Ddx31 UTSW 2 28904684 missense probably benign 0.00
R4972:Ddx31 UTSW 2 28860770 missense probably damaging 1.00
R5240:Ddx31 UTSW 2 28846030 missense probably benign 0.03
R5358:Ddx31 UTSW 2 28863770 missense probably damaging 0.98
R5450:Ddx31 UTSW 2 28886969 missense probably damaging 0.97
R5945:Ddx31 UTSW 2 28859890 missense probably damaging 1.00
R5956:Ddx31 UTSW 2 28874173 missense probably damaging 1.00
R6235:Ddx31 UTSW 2 28844842 missense probably benign 0.00
R6245:Ddx31 UTSW 2 28844982 missense probably benign 0.00
R6463:Ddx31 UTSW 2 28847513 critical splice donor site probably null
R6647:Ddx31 UTSW 2 28875738 missense probably damaging 1.00
R6917:Ddx31 UTSW 2 28892409 missense probably damaging 1.00
R7135:Ddx31 UTSW 2 28848306 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCGGCCAGGAGTAGTAACACAC -3'
(R):5'- ATGCCCTCTCCTGAGAATGC -3'

Sequencing Primer
(F):5'- GAGTAGTAACACACATTGATAAGACC -3'
(R):5'- TCCTGAGAATGCCGTCCTG -3'
Posted On2018-08-29