Incidental Mutation 'R6783:Trim33'
ID 531498
Institutional Source Beutler Lab
Gene Symbol Trim33
Ensembl Gene ENSMUSG00000033014
Gene Name tripartite motif-containing 33
Synonyms 8030451N04Rik, ectodermin, Ecto, Tif1g
MMRRC Submission 044897-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6783 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 103186609-103266086 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103259403 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 1031 (Y1031H)
Ref Sequence ENSEMBL: ENSMUSP00000102473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029444] [ENSMUST00000106860] [ENSMUST00000198706]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000029444
AA Change: Y1031H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029444
Gene: ENSMUSG00000033014
AA Change: Y1031H

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
low complexity region 33 134 N/A INTRINSIC
PHD 138 199 9.85e0 SMART
RING 139 198 2.12e-8 SMART
BBOX 226 273 1.24e-9 SMART
RING 231 293 2.01e0 SMART
BBOX 285 326 1.54e-10 SMART
BBC 333 459 7.55e-45 SMART
low complexity region 540 583 N/A INTRINSIC
low complexity region 731 773 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
PHD 902 945 4.15e-11 SMART
BROMO 972 1095 3.74e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106860
AA Change: Y1031H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102473
Gene: ENSMUSG00000033014
AA Change: Y1031H

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
low complexity region 33 134 N/A INTRINSIC
PHD 138 199 9.85e0 SMART
RING 139 198 2.12e-8 SMART
BBOX 226 273 1.24e-9 SMART
RING 231 293 2.01e0 SMART
BBOX 285 326 1.54e-10 SMART
BBC 333 459 7.55e-45 SMART
low complexity region 540 583 N/A INTRINSIC
low complexity region 731 773 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
PHD 902 945 4.15e-11 SMART
BROMO 972 1078 3.52e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197365
AA Change: Y224H

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000198706
SMART Domains Protein: ENSMUSP00000142585
Gene: ENSMUSG00000033014

DomainStartEndE-ValueType
Blast:BBC 1 30 9e-11 BLAST
low complexity region 111 154 N/A INTRINSIC
low complexity region 302 344 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.8%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a transcriptional corepressor. However, molecules that interact with this protein have not yet been identified. The protein is a member of the tripartite motif family. This motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. Three alternatively spliced transcript variants for this gene have been described, however, the full-length nature of one variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E9.5 with abnormal embryonic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T A 7: 133,576,126 (GRCm39) Q228L probably damaging Het
Arhgap45 A G 10: 79,853,698 (GRCm39) T71A possibly damaging Het
Bag6 T A 17: 35,363,211 (GRCm39) S684T possibly damaging Het
Bcam C T 7: 19,500,806 (GRCm39) G123R probably damaging Het
Cdcp3 T C 7: 130,828,493 (GRCm39) L316P probably damaging Het
Cdr2l C T 11: 115,284,495 (GRCm39) A277V possibly damaging Het
Clcn4 T A 7: 7,302,181 (GRCm39) probably benign Het
Csnk1g1 T A 9: 65,880,794 (GRCm39) I72N probably damaging Het
Cspg4b A T 13: 113,456,743 (GRCm39) K930* probably null Het
Ddx31 G A 2: 28,764,188 (GRCm39) V465I probably benign Het
Ddx54 C T 5: 120,756,779 (GRCm39) Q163* probably null Het
Dnmt3a A G 12: 3,947,406 (GRCm39) E459G probably damaging Het
Dpp8 T C 9: 64,970,844 (GRCm39) S568P possibly damaging Het
Drap1 G T 19: 5,474,219 (GRCm39) T47K probably damaging Het
Epha7 G T 4: 28,950,528 (GRCm39) R777L possibly damaging Het
Far2 T G 6: 148,052,273 (GRCm39) probably null Het
Fhdc1 T C 3: 84,352,834 (GRCm39) K797R probably benign Het
Gm10330 A T 12: 23,830,094 (GRCm39) M29K probably damaging Het
Grik3 A T 4: 125,526,093 (GRCm39) I109F probably benign Het
Il31ra T C 13: 112,688,522 (GRCm39) probably null Het
Itga1 T G 13: 115,133,513 (GRCm39) I466L probably benign Het
Itpr2 A T 6: 146,287,371 (GRCm39) probably null Het
Mical3 A C 6: 120,935,786 (GRCm39) L1580R possibly damaging Het
Or14c43 T A 7: 86,114,835 (GRCm39) V72D probably damaging Het
Or4n4 T C 14: 50,519,644 (GRCm39) D22G probably benign Het
Palb2 T A 7: 121,726,711 (GRCm39) E386D probably damaging Het
Pate8 T A 9: 36,492,631 (GRCm39) probably null Het
Polm C A 11: 5,785,534 (GRCm39) R175L probably damaging Het
Prpf40b C T 15: 99,212,784 (GRCm39) R627W probably damaging Het
Ptcd3 A T 6: 71,885,627 (GRCm39) V33D probably benign Het
Pwwp4c C T X: 73,684,021 (GRCm39) R355H probably damaging Homo
Ripk4 C A 16: 97,549,237 (GRCm39) R273L probably damaging Het
Rpap2 A G 5: 107,803,153 (GRCm39) T612A probably damaging Het
Serpinb10 A G 1: 107,474,597 (GRCm39) N253S possibly damaging Het
Sgpp1 G C 12: 75,782,243 (GRCm39) P32R probably benign Het
Sim1 T C 10: 50,784,823 (GRCm39) I156T possibly damaging Het
Ski A T 4: 155,245,289 (GRCm39) probably null Het
Spaca7b G A 8: 11,705,661 (GRCm39) Q39* probably null Het
Tent2 G A 13: 93,291,526 (GRCm39) A368V probably benign Het
Tent2 C G 13: 93,291,527 (GRCm39) A372P probably benign Het
Trdn C T 10: 33,314,811 (GRCm39) R512C probably damaging Het
Use1 T C 8: 71,821,880 (GRCm39) L188P probably damaging Het
Usp34 G A 11: 23,362,318 (GRCm39) G1588D probably damaging Het
Vmn2r33 C A 7: 7,566,797 (GRCm39) R105L probably benign Het
Vmn2r53 G A 7: 12,335,360 (GRCm39) S100F probably damaging Het
Other mutations in Trim33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Trim33 APN 3 103,237,498 (GRCm39) missense probably benign 0.44
IGL00981:Trim33 APN 3 103,259,311 (GRCm39) splice site probably benign
IGL01010:Trim33 APN 3 103,254,031 (GRCm39) nonsense probably null
IGL01025:Trim33 APN 3 103,261,234 (GRCm39) utr 3 prime probably benign
IGL01082:Trim33 APN 3 103,234,175 (GRCm39) missense possibly damaging 0.49
IGL02245:Trim33 APN 3 103,254,086 (GRCm39) critical splice donor site probably null
IGL02291:Trim33 APN 3 103,234,181 (GRCm39) missense probably damaging 1.00
IGL03248:Trim33 APN 3 103,218,289 (GRCm39) unclassified probably benign
IGL03400:Trim33 APN 3 103,236,459 (GRCm39) missense probably damaging 0.99
abilene UTSW 3 103,228,875 (GRCm39) missense probably damaging 0.99
Bemoaned UTSW 3 103,234,109 (GRCm39) missense possibly damaging 0.92
Excision UTSW 3 103,251,892 (GRCm39) missense probably damaging 1.00
Peaked UTSW 3 103,244,848 (GRCm39) critical splice donor site probably null
Pike UTSW 3 103,218,201 (GRCm39) missense probably damaging 0.98
westworld UTSW 3 103,234,217 (GRCm39) missense possibly damaging 0.46
R0143:Trim33 UTSW 3 103,259,417 (GRCm39) missense probably benign 0.00
R0471:Trim33 UTSW 3 103,234,217 (GRCm39) missense possibly damaging 0.46
R0513:Trim33 UTSW 3 103,217,700 (GRCm39) missense probably damaging 1.00
R0573:Trim33 UTSW 3 103,259,306 (GRCm39) splice site probably benign
R0586:Trim33 UTSW 3 103,217,660 (GRCm39) missense probably damaging 0.99
R1103:Trim33 UTSW 3 103,218,201 (GRCm39) missense probably damaging 0.98
R1157:Trim33 UTSW 3 103,261,146 (GRCm39) missense probably damaging 1.00
R1328:Trim33 UTSW 3 103,260,913 (GRCm39) missense possibly damaging 0.86
R1331:Trim33 UTSW 3 103,217,670 (GRCm39) missense probably damaging 0.99
R1385:Trim33 UTSW 3 103,218,266 (GRCm39) missense possibly damaging 0.46
R1397:Trim33 UTSW 3 103,217,750 (GRCm39) unclassified probably benign
R1785:Trim33 UTSW 3 103,236,536 (GRCm39) frame shift probably null
R1848:Trim33 UTSW 3 103,231,956 (GRCm39) unclassified probably benign
R1903:Trim33 UTSW 3 103,244,760 (GRCm39) missense probably damaging 1.00
R3404:Trim33 UTSW 3 103,228,875 (GRCm39) missense probably damaging 0.99
R3878:Trim33 UTSW 3 103,259,321 (GRCm39) missense probably damaging 1.00
R4156:Trim33 UTSW 3 103,217,630 (GRCm39) missense possibly damaging 0.94
R4281:Trim33 UTSW 3 103,236,402 (GRCm39) missense probably damaging 0.99
R4570:Trim33 UTSW 3 103,237,481 (GRCm39) missense probably damaging 0.96
R4809:Trim33 UTSW 3 103,236,572 (GRCm39) missense possibly damaging 0.91
R4904:Trim33 UTSW 3 103,238,963 (GRCm39) missense possibly damaging 0.46
R5168:Trim33 UTSW 3 103,248,997 (GRCm39) nonsense probably null
R5458:Trim33 UTSW 3 103,237,496 (GRCm39) missense possibly damaging 0.64
R5910:Trim33 UTSW 3 103,251,892 (GRCm39) missense probably damaging 1.00
R6195:Trim33 UTSW 3 103,244,848 (GRCm39) critical splice donor site probably null
R6331:Trim33 UTSW 3 103,248,925 (GRCm39) missense probably benign 0.00
R6636:Trim33 UTSW 3 103,261,035 (GRCm39) missense probably damaging 1.00
R6642:Trim33 UTSW 3 103,244,830 (GRCm39) missense probably damaging 0.99
R6856:Trim33 UTSW 3 103,259,365 (GRCm39) missense probably damaging 0.97
R7220:Trim33 UTSW 3 103,234,109 (GRCm39) missense possibly damaging 0.92
R7325:Trim33 UTSW 3 103,228,952 (GRCm39) missense possibly damaging 0.93
R7374:Trim33 UTSW 3 103,217,639 (GRCm39) missense probably damaging 0.98
R7430:Trim33 UTSW 3 103,218,219 (GRCm39) missense possibly damaging 0.92
R7438:Trim33 UTSW 3 103,253,956 (GRCm39) splice site probably benign
R7491:Trim33 UTSW 3 103,233,464 (GRCm39) missense probably benign 0.28
R8001:Trim33 UTSW 3 103,218,831 (GRCm39) critical splice donor site probably null
R8127:Trim33 UTSW 3 103,239,043 (GRCm39) missense possibly damaging 0.66
R8326:Trim33 UTSW 3 103,218,770 (GRCm39) nonsense probably null
R8334:Trim33 UTSW 3 103,261,145 (GRCm39) missense probably benign 0.06
R8813:Trim33 UTSW 3 103,254,052 (GRCm39) missense probably benign 0.01
R8828:Trim33 UTSW 3 103,236,392 (GRCm39) missense probably damaging 0.97
R8894:Trim33 UTSW 3 103,218,807 (GRCm39) missense probably damaging 1.00
R9239:Trim33 UTSW 3 103,237,453 (GRCm39) missense probably benign 0.08
R9433:Trim33 UTSW 3 103,228,979 (GRCm39) critical splice donor site probably null
R9495:Trim33 UTSW 3 103,239,074 (GRCm39) missense probably benign 0.17
R9514:Trim33 UTSW 3 103,239,074 (GRCm39) missense probably benign 0.17
R9564:Trim33 UTSW 3 103,238,965 (GRCm39) missense probably benign 0.28
R9595:Trim33 UTSW 3 103,259,350 (GRCm39) missense probably damaging 1.00
R9722:Trim33 UTSW 3 103,261,146 (GRCm39) missense possibly damaging 0.55
R9784:Trim33 UTSW 3 103,244,823 (GRCm39) missense possibly damaging 0.66
RF005:Trim33 UTSW 3 103,187,528 (GRCm39) frame shift probably null
RF007:Trim33 UTSW 3 103,187,533 (GRCm39) small deletion probably benign
RF014:Trim33 UTSW 3 103,236,408 (GRCm39) missense possibly damaging 0.94
RF061:Trim33 UTSW 3 103,187,533 (GRCm39) small deletion probably benign
RF064:Trim33 UTSW 3 103,187,511 (GRCm39) frame shift probably null
Z1176:Trim33 UTSW 3 103,261,043 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAGCATGTATCCTGCAGTAAG -3'
(R):5'- TCTTCTCTAGAGCTGAGGGG -3'

Sequencing Primer
(F):5'- CAGCATGTATCCTGCAGTAAGATCTG -3'
(R):5'- CTCTATAGGTTGGAAGCTAACA -3'
Posted On 2018-08-29