Incidental Mutation 'R6783:Gm17689'
ID531517
Institutional Source Beutler Lab
Gene Symbol Gm17689
Ensembl Gene ENSMUSG00000091248
Gene Namepredicted gene, 17689
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6783 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location36581278-36582635 bp(-) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) T to A at 36581335 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126891 (fasta)
Predicted Effect probably null
Transcript: ENSMUST00000170030
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.8%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik G A 8: 11,655,661 Q39* probably null Het
5430419D17Rik T C 7: 131,226,764 L316P probably damaging Het
Adam12 T A 7: 133,974,397 Q228L probably damaging Het
Arhgap45 A G 10: 80,017,864 T71A possibly damaging Het
Bag6 T A 17: 35,144,235 S684T possibly damaging Het
BC067074 A T 13: 113,320,209 K930* probably null Het
Bcam C T 7: 19,766,881 G123R probably damaging Het
Cdr2l C T 11: 115,393,669 A277V possibly damaging Het
Clcn4 T A 7: 7,299,182 probably benign Het
Csnk1g1 T A 9: 65,973,512 I72N probably damaging Het
Ddx31 G A 2: 28,874,176 V465I probably benign Het
Ddx54 C T 5: 120,618,714 Q163* probably null Het
Dnmt3a A G 12: 3,897,406 E459G probably damaging Het
Dpp8 T C 9: 65,063,562 S568P possibly damaging Het
Drap1 G T 19: 5,424,191 T47K probably damaging Het
Epha7 G T 4: 28,950,528 R777L possibly damaging Het
Far2 T G 6: 148,150,775 probably null Het
Fhdc1 T C 3: 84,445,527 K797R probably benign Het
Gm10330 A T 12: 23,780,093 M29K probably damaging Het
Gm5640 C T X: 74,640,415 R355H probably damaging Homo
Grik3 A T 4: 125,632,300 I109F probably benign Het
Il31ra T C 13: 112,551,988 probably null Het
Itga1 T G 13: 114,996,977 I466L probably benign Het
Itpr2 A T 6: 146,385,873 probably null Het
Mical3 A C 6: 120,958,825 L1580R possibly damaging Het
Olfr299 T A 7: 86,465,627 V72D probably damaging Het
Olfr732 T C 14: 50,282,187 D22G probably benign Het
Palb2 T A 7: 122,127,488 E386D probably damaging Het
Papd4 G A 13: 93,155,018 A368V probably benign Het
Papd4 C G 13: 93,155,019 A372P probably benign Het
Polm C A 11: 5,835,534 R175L probably damaging Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Ptcd3 A T 6: 71,908,643 V33D probably benign Het
Ripk4 C A 16: 97,748,037 R273L probably damaging Het
Rpap2 A G 5: 107,655,287 T612A probably damaging Het
Serpinb10 A G 1: 107,546,867 N253S possibly damaging Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Sim1 T C 10: 50,908,727 I156T possibly damaging Het
Ski A T 4: 155,160,832 probably null Het
Trdn C T 10: 33,438,815 R512C probably damaging Het
Trim33 T C 3: 103,352,087 Y1031H probably damaging Het
Use1 T C 8: 71,369,236 L188P probably damaging Het
Usp34 G A 11: 23,412,318 G1588D probably damaging Het
Vmn2r33 C A 7: 7,563,798 R105L probably benign Het
Vmn2r53 G A 7: 12,601,433 S100F probably damaging Het
Other mutations in Gm17689
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Gm17689 APN 9 36581363 missense probably benign 0.00
IGL01693:Gm17689 APN 9 36581366 missense probably benign 0.31
IGL02268:Gm17689 APN 9 36581870 missense possibly damaging 0.71
IGL03191:Gm17689 APN 9 36581402 missense probably benign 0.00
PIT4354001:Gm17689 UTSW 9 36581301 missense possibly damaging 0.71
R0401:Gm17689 UTSW 9 36582628 missense unknown
R0743:Gm17689 UTSW 9 36581301 missense probably benign 0.03
R1483:Gm17689 UTSW 9 36581324 missense probably benign 0.00
R1701:Gm17689 UTSW 9 36581818 critical splice donor site probably benign
R2258:Gm17689 UTSW 9 36581865 missense probably benign 0.03
R3764:Gm17689 UTSW 9 36581818 critical splice donor site probably null
R5143:Gm17689 UTSW 9 36581904 missense probably benign 0.31
R7013:Gm17689 UTSW 9 36582558 missense unknown
R7014:Gm17689 UTSW 9 36582558 missense unknown
Predicted Primers PCR Primer
(F):5'- CTAGAAATGAAGAGTGGCAATTCAACC -3'
(R):5'- TAGATGAATGATCGCCCTGAG -3'

Sequencing Primer
(F):5'- CTAACAGACAGGTATCAGGGCCTTG -3'
(R):5'- AATGATCGCCCTGAGATTCTGGATC -3'
Posted On2018-08-29