Incidental Mutation 'R6784:Mgat3'
ID531577
Institutional Source Beutler Lab
Gene Symbol Mgat3
Ensembl Gene ENSMUSG00000042428
Gene Namemannoside acetylglucosaminyltransferase 3
SynonymsGnT-III, 1110038J12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R6784 (G1)
Quality Score185.009
Status Validated
Chromosome15
Chromosomal Location80173721-80215519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80212200 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 409 (Q409H)
Ref Sequence ENSEMBL: ENSMUSP00000043077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044970]
Predicted Effect probably damaging
Transcript: ENSMUST00000044970
AA Change: Q409H

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043077
Gene: ENSMUSG00000042428
AA Change: Q409H

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 73 87 N/A INTRINSIC
Pfam:Glyco_transf_17 191 362 3.2e-28 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.2%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are believed to be over 100 different glycosyltransferases involved in the synthesis of protein-bound and lipid-bound oligosaccharides. The enzyme encoded by this gene transfers a GlcNAc residue to the beta-linked mannose of the trimannosyl core of N-linked oligosaccharides and produces a bisecting GlcNAc. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced DEN and PB-induced hepatic tumors and reduced hepatocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,468,935 Y210* probably null Het
Aass C T 6: 23,093,896 S142N probably null Het
Aida A G 1: 183,322,491 Y275C probably damaging Het
Arrdc4 A G 7: 68,748,846 I74T probably benign Het
C1ql4 A G 15: 99,087,409 V107A probably benign Het
Ccnh T C 13: 85,212,765 V284A probably benign Het
Cd180 A G 13: 102,702,705 E32G probably damaging Het
Chd6 T C 2: 160,966,254 D1680G probably damaging Het
Cog7 A T 7: 121,964,293 probably null Het
Cyp2j6 T A 4: 96,535,504 Q209L possibly damaging Het
Dars A T 1: 128,391,347 V116E probably damaging Het
Dnah10 A G 5: 124,777,826 K1932E probably damaging Het
Dock9 A G 14: 121,543,514 S2086P probably damaging Het
Espl1 C G 15: 102,299,225 R375G probably benign Het
Fer1l6 C T 15: 58,571,426 S526L possibly damaging Het
Galnt9 G A 5: 110,620,599 R587H probably damaging Het
Gigyf2 G T 1: 87,443,674 V1170L probably damaging Het
Gm14412 G T 2: 177,317,340 T41K probably benign Het
Gm45861 A G 8: 27,500,058 probably null Het
Gm5640 C T X: 74,640,415 R355H probably damaging Homo
Hist1h2bc T C 13: 23,684,500 I90T probably damaging Het
Hoxc5 A G 15: 103,013,890 probably benign Het
Klra1 T C 6: 130,372,854 D207G probably benign Het
Lancl2 A G 6: 57,703,255 N57D probably benign Het
Map2k4 T C 11: 65,691,751 probably benign Het
Mpp3 T A 11: 102,002,148 probably null Het
Myh1 T A 11: 67,214,570 L1062Q probably damaging Het
Nebl T A 2: 17,434,914 K183* probably null Het
Npat G C 9: 53,558,158 D315H probably damaging Het
Nt5c2 A G 19: 46,924,327 V63A probably damaging Het
Olfr1123 C T 2: 87,418,452 R135C probably benign Het
Olfr389 T G 11: 73,776,850 H159P probably damaging Het
Olfr491 A T 7: 108,317,782 D296V probably damaging Het
Olfr574 A T 7: 102,948,515 T17S possibly damaging Het
Opn1sw T A 6: 29,379,847 E129D probably damaging Het
Prdm16 T C 4: 154,323,307 Y1153C probably damaging Het
Prdm6 T A 18: 53,536,626 D105E probably benign Het
Rbm27 T C 18: 42,301,864 M331T probably benign Het
S1pr1 A G 3: 115,712,061 Y295H probably damaging Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Sla2 C T 2: 156,883,669 S3N unknown Het
Slc10a6 A G 5: 103,629,030 I68T probably damaging Het
Slc5a1 T C 5: 33,158,116 F493S probably benign Het
Snx14 A T 9: 88,381,792 Y847N probably benign Het
Tmc1 A G 19: 20,827,651 probably null Het
Vps8 C A 16: 21,563,207 Q1130K probably benign Het
Other mutations in Mgat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Mgat3 APN 15 80212433 missense probably damaging 1.00
IGL01134:Mgat3 APN 15 80212176 missense probably benign 0.17
R0077:Mgat3 UTSW 15 80212577 missense probably benign 0.00
R1171:Mgat3 UTSW 15 80211637 missense probably benign 0.26
R1885:Mgat3 UTSW 15 80211619 missense probably benign 0.25
R1886:Mgat3 UTSW 15 80211619 missense probably benign 0.25
R1986:Mgat3 UTSW 15 80212189 missense probably benign 0.04
R2125:Mgat3 UTSW 15 80211886 missense probably benign 0.00
R3081:Mgat3 UTSW 15 80211854 missense probably benign 0.33
R4819:Mgat3 UTSW 15 80212349 missense probably damaging 1.00
R4992:Mgat3 UTSW 15 80212542 missense probably benign
R5083:Mgat3 UTSW 15 80211298 missense possibly damaging 0.92
R5356:Mgat3 UTSW 15 80211610 missense possibly damaging 0.88
R5356:Mgat3 UTSW 15 80212454 missense probably damaging 1.00
R6508:Mgat3 UTSW 15 80212024 missense possibly damaging 0.90
R7021:Mgat3 UTSW 15 80212454 missense probably damaging 1.00
R7056:Mgat3 UTSW 15 80211896 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGGTTTCTTCTGGAAGCAGCC -3'
(R):5'- TACATGTGCTCACTGGGGTC -3'

Sequencing Primer
(F):5'- TGGAAGCAGCCGGGCAC -3'
(R):5'- AGGGTACTCCTGCTGCGTTC -3'
Posted On2018-08-29